Jantz et al.v.Jantz et al. V. Jantz et al. V. Jantz et al. V. GALETTO et al. V. Jantz et al. V. Jantz et al.Download PDFPatent Trials and Appeals BoardOct 13, 202015865075 - (J) (P.T.A.B. Oct. 13, 2020) Copy Citation BoxInterferences@uspto.gov Entered: October 13, 2020 Tel: 571-272-4683 UNITED STATES PATENT AND TRADEMARK OFFICE BEFORE THE PATENT TRIAL AND APPEALS BOARD DEREK JANTZ, JAMES JEFFERSON SMITH, MICHAEL G. NICHOLSON, DANIEL T. MACLEOD, JEYARAJ ANTONY, AND VICTOR BARTSEVICH, JUNIOR PARTY (PATENTS 10,093,900; 9,993,502; 9,969,975; 9,950,011; 9,889,161; 9,889,160) V. ROMAN GALETTO, AGNES GOUBLE, STEPHANIE GROSSE, CECILE MANNIOUI, LAURENT POIROT, ANDREW SCHARENBERG, AND JULIANNE SMITH SENIOR PARTY (APPLICATION 16/027,629). PATENT INTERFERENCE NO. 106,117 (TECHNOLOGY CENTER 1600) Before: SALLY GARDNER LANE, JAMES T. MOORE, and DEBORAH KATZ, Administrative Patent Judges. LANE, Administrative Patent Judge. JUDGMENT - Bd. R. 127(a) Interference 106,118 -2- A decision granting Jantz Motion 3 of has been entered. (Decision, 1 Paper 215). As a result of this Decision, the involved claims of senior party Galetto 2 are unpatentable and Galetto lacks standing to continue in the interference. 3 Bd. R. 201. Accordingly, we enter judgment against Galetto. 4 5 Order 6 It is 7 ORDERED that judgment on priority is entered against senior party Galetto 8 as to Count 1, the sole Count of the interference (Declaration, Paper 1, 5); 9 FURTHER ORDERED that claims 26, 28-30, 32, and 33 of Galetto 10 application 16/027,629, which correspond to Count 1, are FINALLY REFUSED. 11 (Declaration, Paper 1, 5); 35 U.S.C. § 135(a);1 12 FURTHER ORDERED that the parties are directed to 35 USC § 135(c) and 13 Bd. R. 205 regarding the filing of settlement agreements; 14 FURTHER ORDERED that a party seeking judicial review timely serve 15 notice on the Director of the United States Patent and Trademark Office; 16 37 C.F.R. §§ 90.1 and 104.2. See also Bd. R. 8(b). Attention is directed to Biogen 17 Idec MA, Inc., v. Japanese Foundation for Cancer Research, 785 F.3d 648, 18 654–57 (Fed. Cir. 2015) (determining that pre-AIA § 146 review was eliminated for 19 interference proceedings declared after September 15, 2012); and 20 1 Any reference to a statute in this Judgment is to the statute that was in effect on March 15, 2013 unless otherwise indicated. See Pub. L. 112-29, § 3(n), 125 Stat. 284, 293 (2011). Interference 106,118 -3- FURTHER ORDERED that a copy of this judgment be entered into the 1 administrative records of the involved Jantz patents and Galetto application. 2 3 cc (via email): 4 5 Attorney for Jantz: 6 7 Edward R. Gates 8 Michael J. Twomey 9 Eric P. Greenwald 10 WOLF, GREENFIELD & SACKS, P.C. 11 egates-ptab@wolfgreenfield.com 12 michael.twomey@wolfgreenfield.com 13 eric.greenwald@wolfgreenfield.com 14 15 Attorney for Galetto: 16 17 Salvatore J. Arrigo 18 Scott M. K. Lee 19 Harry J. Guttman 20 ARRIGO, LEE, GUTTMAN & 21 MOUTA-BELLUM LLP 22 sal@arrigo.us 23 24 25 BoxInterferences@uspto.gov Entered: October 13, 2020 Tel: 571-272-4683 UNITED STATES PATENT AND TRADEMARK OFFICE _______________ BEFORE THE PATENT TRIAL AND APPEAL BOARD _______________ DEREK JANTZ, JAMES JEFFERSON SMITH, MICHAEL G. NICHOLSON, DANIEL T. MACLEOD, JEYARAJ ANTONY, AND VICTOR BARTSEVICH, Junior Party (Patents 10,093,900; 9,993,502; 9,969,975; 9,950,011; 9,889,161; 9,889,160) v. ROMAN GALETTO, AGNES GOUBLE, STEPHANIE GROSSE, CECILE MANNIOUI, LAURENT POIROT, ANDREW SCHARENBERG, and JULIANNE SMITH Senior Party (Application 16/027,629). Patent Interference No. 106,117 (Technology Center 1600) _______________ Before: SALLY GARDNER LANE, JAMES T. MOORE, and DEBORAH KATZ, Administrative Patent Judges. LANE, Administrative Patent Judge. Decision - Motions - 37 C.F.R. § 41.125 Interference 106,118 2 I. Introduction 1 The interference was declared under 35 U.S.C. § 135(a)1 on August 19, 2019 2 between junior party Derek Jantz, James Jefferson Smith, Michael G. Nicholson, 3 Daniel T. MacLeod, Jeyaraj Antony, and Victor Bartsevich (“Jantz”)2 and senior 4 party Roman Galetto, Agnes Gouble, Stephanie Grosse, Cecile Mannioui, Laurent 5 Poirot, Andrew Scharenberg, and Julianne Smith (“Galetto”).34 (Declaration, 6 Paper 1). 7 Galetto is involved on the basis of application 16/027,629 (’629), filed 8 July 5, 2018. (’629 Application, Ex. 2004).5 Jantz is involved on the basis of the 9 following six patents: 10 (1) 10,093,900, issued October 09, 2018, application 15/964,446, 11 filed April 27, 2018; 12 (2) 9,993,502, issued June 12, 2018, application 15/865,055, 13 filed January 08, 2018; 14 (3) 9,969,975, issued May 15, 2018, application 15/865,089, 15 filed January 08, 2018; 16 (4) 9,950,011, issued April 24, 2018, application 15/865,075, 17 filed January 08, 2018; 18 1 Any reference to a statute in this decision is to the statute that was in effect on March 15, 2013 unless otherwise indicated. See Pub. L. 112-29, § 3(n), 125 Stat. 284, 293 (2011). 2 Jantz identifies Precision BioSciences, Inc. as the real party in interest of its involved patents. (Jantz Real Party Notice, Paper 9). 3 Galetto identifies Cellectis as the real party in interest, and Allogene Therapeutics, Inc., Les Laboratoires Servier, and Institut de Recherches Internationales Servier as licensees, of its involved application. (Galetto Real Party Notice, Paper 4). 4 The parties are involved in related interference 106,118, involving the same Galetto application but different Jantz patents. Judgment was entered against Galetto on September 30, 2020 in that interference. (’118, Judgment, Paper 207). 5 Exhibit 2004 is the published application, US 2018/0360883 A1, published December 20, 2018. Interference 106,118 3 (5) 9,889,161, issued February 13, 2018, application 15/607,059, 1 filed May 26, 2017; and 2 (6) 9,889,160, issued February 13, 2018, application 15/606,995, 3 filed May 26, 2017. 4 5 Jantz filed two substantive motions as did Galetto.6 One of the motions 6 before us, Jantz Motion 3 seeking judgment against Galetto on the basis that all the 7 involved Galetto claims are unpatentable for failure to comply with the written 8 description requirement of the first paragraph of 35 U.S.C. §112, raises a threshold 9 issue under Bd. R. 201. (Jantz Motion 3, Paper 96). Galetto opposed this motion. 10 (Galetto Opposition 3, Paper 176). Jantz replied. (Jantz Reply 3, Paper 193). 11 Because Jantz Motion 3 raises a threshold issue under Bd. R. 201, i.e., an issue 12 that, if resolved in favor of the movant, would deprive the opponent of standing in 13 the interference, we first consider this motion.7 14 We grant the motion. 15 16 II. Discussion 17 The evidence supports any findings of fact in this Decision by a 18 preponderance of the evidence. The moving party has the burden of proof and 19 must support its motion with appropriate evidence such that, if unrebutted, it would 20 justify the relief sought. Bd. R. 208(b). 21 22 6 The panel decided that no oral argument was necessary and none was ordered. 7 Galetto does not contest that Jantz Motion 3 raises a threshold issue and urges that its Motion 1 also raises a threshold issue. (Galetto Motion 1, Paper 24, 1:15-2:11). As discussed further within this decision, we do not find the Galetto motion to raise a threshold issue. Interference 106,118 4 A. Jantz Motion 3 1 Subject matter of the interference 2 T cells provoke an immune response through T cell receptors (“TCRs”), 3 which detect antigens expressed by pathogens or mutant cells. Cancer cells do not 4 always express antigens that can be detected by the TCRs sufficiently to mediate 5 killing of these cells. (Fry Declaration, Ex. 2003, ¶ 31, citing ’629 Application, 6 Ex. 2004, ¶ 8). The invention claimed by Galetto is directed generally to T cells 7 that have been genetically modified through the introduction of a gene encoding a 8 chimeric antigen receptor (“CAR”). CARs are synthetic receptors that are 9 designed to detect a target antigen (e.g., tumor antigen) to generate an immune 10 response against the antigen. CARs can be introduced to T cells ex vivo in either 11 autologous cells (cells that are taken from the patient’s own body) or allogeneic 12 cells (cells that are taken from a donor that is not the intended patient). (Fry 13 Declaration, Ex. 2003, ¶ 32, citing ’629 Application, Ex. 2004, ¶¶ 4-6, 216). TCR 14 from a donor may be recognized by a patient as foreign tissue, resulting in graft 15 versus host disease (GvHD). (Fry Declaration, Ex. 2003, ¶ 41, citing 16 ’629 Application, Ex. 2004, ¶ 6). 17 The claimed invention calls for integration of a CAR sequence into the 18 T cell receptor alpha gene (“TCRα”) in a single genetic modification step using, 19 e.g., homologous recombination (“HR”).8 (Fry Declaration, Ex. 2003, ¶¶ 73; 96; 20 8 Homologous recombination is a DNA repair process by which homologous sequences are incorporated. (Galetto Opposition 3, Paper 176, 8:2-3 citing Osborn Declaration, Ex. 1041, ¶ 44). Integration by HR refers to a “natural, cellular process in which a double-stranded DNA-break is repaired using a homologous DNA sequence as the repair template,” where the “homologous DNA sequence may be an endogenous chromosomal sequence or an exogenous nucleic acid that was delivered to the cell.” (Fry Declaration, Ex. 2003, ¶ 37, citing ’975 Jantz patent, Ex. 2021, 26:49-56; ’629 Application, Ex. 2004, ¶ 98). Interference 106,118 5 Galetto Clean Copy of Claims, Paper 7). This results in modified T cells having 1 reduced TCR expression on the cell surface as well as CAR expression for antigen 2 detection. The modified T cells may provide a better treatment option since the 3 reduction of TCR expression decreases the possibility of GvHD making the use of 4 donor cells safer for a patient. (’629 Application, Ex. 2004, ¶¶ 2, 11, 16; Galetto 5 Opposition 3, Paper 176, 18:2-4).9 6 Galetto involved claim 7 According to the ’629 specification, in an embodiment of the invention 8 where TCRα is inactivated, T cells are engineered to allow their proliferation while 9 the TCRα gene is inactivated and where the engineered T cells are then further 10 transformed with a CAR sequence. (’629 Application, Ex. 2004, ¶¶ 15, 16). 11 12 Galetto claims 26, 28-30, 32, and 33 are involved in the interference. 13 Claim 26 is illustrative of the involved claims and is as follows: 14 15 26. An isolated genetically modified human T cell in which a 16 T cell receptor (TCR) alpha gene has been modified by cleavage with 17 a TALEN encoded by electroporated RNAs and integration by 18 homologous recombination into the TCR alpha constant chain region 19 of an exogenous nucleic acid successively comprising: 20 a first region of homology to sequences upstream of said 21 cleavage with the TALEN, an exogenous polynucleotide sequence 22 encoding a Chimeric Antigen Receptor, 23 and a second region of homology to sequences downstream of 24 said cleavage with the TALEN, 25 9 The claimed invention also includes a requirement for modification of the CD52 gene to make the T cells resistant to immunosuppressive drugs, administered to prevent a patient from rejecting donor T cells. (Fry Declaration, Ex. 2003, ¶ 58; ’629 Application, Ex. 2004, ¶ 7). This limitation is not the subject of the parties’ dispute. Interference 106,118 6 wherein the Chimeric Antigen Receptor comprises a binding 1 domain against a tumor antigen present on a target cell, 2 wherein the cell expresses the Chimeric Antigen Receptor, and 3 wherein the integration by homologous recombination results in 4 reduced TCR expression on the cell surface, 5 wherein the integration by homologous recombination into the 6 TCR alpha constant chain region is at a position within the sequence: 7 TTGTCCCACA GATATCCAGACCCTGACCC TGCCGTGTAC 8 CAGCTGAGA (SEQ ID NO: 37), wherein the TALEN is encoded by 9 RNAs having the nucleotide sequences of SEQ ID NO:49 and SEQ 10 ID NO: 50; and 11 wherein the CD52 gene in the cell has been modified by 12 cleavage with a TALEN at a position within the sequence: 13 TTCCTCCTAC TCACCATCAG CCTCCTGGTTATGGTACAGG 14 TAAGAGCAA (SEQ ID NO: 40), wherein the TALEN is encoded by 15 RNAs having the nucleotide sequences of SEQ ID NO:55 and SEQ 16 ID NO:56. 17 18 (Galetto Clean Copy of Claims, Paper 7, relevant portions underlined; Fry 19 Declaration, Ex. 2003 ¶¶ 72-77). 20 21 Claims 28-30 depend from claim 26 and therefore also require that the CAR 22 sequence is integrated into the TCRα constant region gene by HR. Claims 32 and 23 33 are independent claims. 24 Like claim 26, claim 32 requires “an exogenous polynucleotide sequence 25 encoding a Chimeric Antigen Receptor inserted into the T cell receptor (TCR) 26 alpha constant chain region … by … integration by homologous recombination 27 into the TCR alpha constant chain region….” resulting in “reduced TCR 28 expression on the cell surface when compared to normal T lymphocytes.” (Galetto 29 Clean Copy of Claims, Paper 7; Fry Declaration, Ex. 2003 ¶ 79). 30 Claim 33 requires “a polynucleotide expressing a Chimeric Antigen 31 Receptor (CAR); wherein … integration of the polynucleotide expressing the CAR 32 Interference 106,118 7 into the TCR alpha gene inactivates the TCR alpha gene”. (Galetto Clean Copy of 1 Claims, Paper 7; Fry Declaration, Ex. 2003 ¶ 80). Claim 33 differs from the other 2 claims in that it does not contain language requiring integration of the 3 polynucleotide expressing the CAR to be “by homologous combination.” 4 5 6 Summary of parties’ positions 7 Jantz asserts, and Galetto does not dispute, that the involved Galetto claims 8 require “genetically modified human T cells wherein the endogenous T cell 9 receptor alpha constant region gene (“TCRα gene”) is inactivated by integrating, 10 via homologous recombination (“HR”), a sequence encoding a chimeric antigen 11 receptor (“CAR sequence”) into the TCRα gene.” (Jantz Motion 3, Paper 96, 1:13-12 16; Galetto Opposition 3, Paper 176, 2:11-14). While Jantz concedes that the 13 ’629 specification discloses (i) “a T cell having an inactivated TCRα gene” and (ii) 14 “integrating an exogenous DNA encoding a CAR into these T cells”, Jantz argues 15 that there is no description within the ’629 specification of integrating a CAR by 16 HR into the TCRα gene specifically with the resulting inactivation of the gene. 17 (Jantz Reply 3, Paper 193, 1:22-2:7). Thus the parties dispute centers around 18 whether the ’629 specification provides written description of that portion of the 19 Galetto involved claims requiring modified T cells having a CAR sequence that is 20 integrated specifically into the TCRα gene by homologous recombination thus 21 inactivating the gene. (“contested limitation”). (Fry Declaration, Ex. 2003, ¶ 96).10 22 As discussed in the Jantz motion, on July 6, 2018, one day after filing its 23 involved ’629 application, Galetto filed a paper requesting an interference with, 24 inter alia, five of the six Jantz involved patents. In that request Galetto cancelled 25 10 As discussed further below, claim 33 does not contain an express requirement that the CAR to be integrated via HR. Interference 106,118 8 its previous claims and presented new claims, including the currently involved 1 claims, that appear to be substantially the same as, but not identical to, claim 1 of 2 Jantz involved patent 9,969,975. (Galetto Amendment and Suggestion of 3 Interference, Ex. 2012, 6, 8). 4 The new claims were rejected for lacking written description of the “specific 5 concept of inserting an exogenous CAR coding sequence into the TCR alpha gene, 6 particularly the TCR alpha constant region.” (Examiner Action, Ex. 2013, 2). 7 While the claims were later amended, a requirement that a CAR sequence be 8 integrated into the TCRα gene remained. (Galetto Amendment, Ex. 2014, 2-5). 9 The Examiner initially maintained the position that the new claims lacked 10 written description, but then later withdrew the rejection and allowed all the claims 11 of the ’629 application (Examiner’s Action, Ex. 2015, 7; Office Action dated 12 August 09, 2019). 13 Jantz asserts that the Examiner was correct in rejecting Galetto’s copied 14 claims for not having written description support for the concept of inserting a 15 CAR coding sequence into the TCRα gene, particularly the TCR alpha constant 16 region at the cleavage site that inactivates the TCRα gene. Jantz urges that it 17 disagrees with Galetto’s position, taken during ex parte prosecution of the 18 ’629 application, that “a CAR and pTalpha are two interchangeable species” and 19 that therefore paragraphs 103 (“¶ 103”) and 124 (“¶ 124”) of the Galetto 20 specification considered together provide sufficient description. (Jantz Motion 3, 21 Paper 96, 2:5-7; Galetto Amendment and Response, Ex. 2020, 7). 22 Jantz argues that, because a CAR and pTα are not two interchangeable 23 species for the purposes of paragraph 124, one skilled in the art would not have 24 read paragraphs 103 and 124 together nor have understood these paragraphs to 25 disclose the concept of inserting a CAR coding sequence into the TCRα 26 inactivating the TCRα gene. (Jantz Motion 3, Paper 96, 2:8-3:3, citing Galetto 27 Interference 106,118 9 Amendment and Response filed July 26, 2019, Ex. 2013, 2). Further, Jantz argues, 1 nowhere else does the ’629 specification provide descriptive support for the 2 concept such that one skilled in the art would have understood Galetto to have 3 possessed invention of the Galetto involved claims. (Jantz Motion 3, Paper 96, 3:4-4 4:5; 20:11-13). 5 Galetto argues that its involved specification describes the claimed invention 6 and specifically that portion in dispute. According to Galetto its specification 7 describes genetically modified human T cells where the T cell’s TCRα gene is 8 inactivated by integrating, using HR, a sequence encoding a CAR into the TCRα 9 gene and as required by the Galetto involved claims. (Galetto Opposition 3, 10 Paper176, 3:1-5). Galetto argues that sufficient description is provided where its 11 specification discusses introducing an exogenous sequence encoding at least one 12 recombinant protein of interest into the TCRα gene. According to Galetto, one 13 skilled in the art would have understood that a “recombinant protein of interest” 14 referred to in the ’629 specification could be a CAR given the disclosure of CAR 15 as a protein of interest and the numerous references to CARs elsewhere within the 16 Galetto specification. (Galetto Opposition, Paper 176, 6:23-7:15, citing Osborn 17 Declaration, Ex. 1041, ¶¶ 35, 37, 38; Fry Deposition, Ex. 1040, 21:12-22; 18 ’629 application, ¶¶ 102, 118). 19 Galetto argues that the ’629 specification also describes that the genome 20 modification of a T cell can be performed through homologous recombination such 21 that one skilled in the art would have understood that an exogenous polynucleotide 22 sequence could be introduced through homologous recombination into the TCRα 23 gene. (Galetto Opposition, Paper 176, 7:17-20, citing Osborn Declaration, 24 Ex. 1041, ¶¶ 39, 40). 25 26 Interference 106,118 10 Summary of Decision 1 We find that the ’629 specification does not provide sufficient “blaze marks” 2 pointing to integrating a CAR sequence into the TCRα gene leading to inactivation 3 of the gene. While individual elements of the contested limitation can be found 4 within the ’629 specification, we find, based on the evidence before us, that one 5 skilled in the art would not have been led to a modified T cell having a CAR 6 sequence that is integrated specifically into the TCRα gene thus inactivating the 7 TCRα. 8 9 Legal Principles 10 We give claims their broadest reasonable interpretation by considering not 11 only the claim language but also how one skilled in the art would understand the 12 claim in view of the specification. Phillips v. AWH, 415 F.3d 1303, 1316, (Fed. 13 Cir. 2005). As explained in Agilent Techs., Inc. v. Affymetrix, Inc., claims copied 14 from another are construed in view of the originating specification for purposes of 15 evaluating written description support. Agilent v. Affymetrix, Inc., 567 F.3d 1366, 16 1375 (Fed. Cir. 2009). In the present circumstances there appears to be no dispute 17 that Galetto presented claims in the ’629 application that are substantially the same 18 as, but not identical to, Jantz patent claims. (Galetto Amendment and Suggestion 19 of Interference, Ex. 2012, 7, 8).11 To the extent we must construe Galetto the 20 Galetto involved claims in view of the Jantz patent specification, such construction 21 does not appear to result in any meaningful difference in how the claim terms are 22 construed. The parties do not argue that the construction of the Galetto involved 23 claims differs according to which of the parties’ specifications is consulted. 24 11 In the Request Galetto stated that claim 26 of the ’629 application is substantially the same as claim 1 of Jantz patent 9,969,975. Interference 106,118 11 In evaluating written description we consider whether the disclosure of the 1 application reasonably conveys to those skilled in the art that the inventor had 2 possession of the claimed subject matter as of the filing date. Vas–Cath Inc. v. 3 Mahurkar, 935 F.2d 1555, 1562–63 (Fed.Cir.1991). Thus one skilled in the art, 4 reading the original disclosure, must “immediately discern the limitation at issue.” 5 Waldemar Link GmbH & Co. v. Osteonics Corp., 32 F.3d 556, 558, Fed.Cir.1994). 6 In haec verba support is not necessary. Fujikawa v. Wattanasin, 93 F.3d 7 1559, 1570, (Fed. Cir. 1996). Whether the inventor has provided adequate written 8 description, either explicitly or inherently, must be determined from the disclosure 9 considered as a whole. Reiffin v. Microsoft Corp., 214 F.3d 1342 (1346 Fed. Cir. 10 2000). 11 The written description issue requires we consider the perspective of a 12 person of ordinary skill in the art with the understanding that “the level of detail 13 required ... varies depending on the nature and scope of the claims and on the 14 complexity and predictability of the relevant technology.” Ariad Pharms., Inc. v. 15 Eli Lilly & Co., 598 F.3d 1336, 1351 (Fed. Cir. 2010). We therefore consider 16 whether the technology involved is unpredictable in determining whether the 17 claims are sufficiently described. Capon v. Eshhar, 418 F.3d 1349, 1359 (Fed. Cir. 18 2005). (“It is well recognized that in the ‘unpredictable’ fields of science, it is 19 appropriate to recognize the variability in the science in determining the scope of 20 the coverage to which the inventor is entitled. Such a decision usually focuses on 21 the exemplification in the specification.”). 22 Where a claimed invention is not disclosed with specificity in the underlying 23 specification, we look to see if there are “sufficient ‘blaze marks’ to guide a reader 24 through the forest of disclosed possibilities” to the specifically claimed invention. 25 Novozymes A/S v. DuPont Nutrition Biosciences, 723 F.3d 1336, 1346 (Fed. Cir. 26 2013), citing In re Ruschig, 379 F.2d 990, 994-995 (CCPA 1967). A “mere wish 27 Interference 106,118 12 or plan” for obtaining the claimed invention does not satisfy the written description 1 requirement. Regents of the Univ. of Cal. v. Eli Lilly & Co., 119 F.3d 1559, 1566 2 (Fed.Cir.1997). 3 “[W]hile the description requirement does not demand any particular form 4 of disclosure… a description that merely renders the invention obvious does not 5 satisfy the requirement, Ariad, 698 F.3d 1352, citing Carnegie Mellon Univ. v. 6 Hoffmann–La Roche Inc., 541 F.3d 1115, 1122 (Fed. Cir. 2008) and Lockwood v. 7 Am. Airlines, 107 F.3d 1565, 1571–72 (Fed.Cir.1997). 8 9 Discussion 10 As the moving party Jantz has the burden of proving it is entitled to the 11 requested relief. To be sufficient, the motion must provide a showing supported 12 with appropriate evidence such that, if unrebutted, it would justify the relief 13 sought. Bd. R. 208(b). We separately discuss those specific portions of the 14 ’629 specification pointed out and relied upon by the parties in their briefing. 15 However, we make a determination of whether the claimed invention is 16 sufficiently described by considering the disclosure as a whole. Reiffin v. 17 Microsoft Corp., 214 F.3d at 1346. 18 Jantz directs us to, inter alia, the testimony of Dr. Terry Fry to support the 19 arguments made within Jantz Motion 3.12 Dr. Fry characterizes a hypothetical 20 person of ordinary skill in the art time period as having a Ph.D., M.D. or 21 M.D./Ph.D. with specific training in the areas of molecular biology and 22 immunology or related disciplines with substantial research or industrial 23 experience in adoptive cell therapy for cancer and the use of genetically modified 24 12 We have reviewed Dr. Fry’s credentials and find Dr. Fry qualified to testify regarding the technical issues discussed in his testimony. (Fry Declaration, Ex. 2003, ¶¶ 5-16; Fry Curriculum vitae (Appendix A of Ex. 2003)). Interference 106,118 13 T cells for this purpose. (Fry Declaration, Ex. 2003, ¶ 28). A person having 1 ordinary skill in the art is presumed to know the relevant prior art. In re GPAC, 57 2 F.3d 1573, 1579 (Fed. Cir. 1995). Galetto does not dispute Dr. Fry’s 3 characterization of such a person and we find that such a person may have the 4 education and experiences that Dr. Fry lists in his testimony. 5 Dr. Fry testified that “T cell gene editing for immunotherapy remains a 6 highly unpredictable field” (Fry Declaration, Ex. 2003, ¶¶ 127, 128, citing, e.g., 7 Sather13 as describing specific challenges associated with the development and 8 optimization of targeted integration into the T cell genome”). 9 Jantz argues that the Galetto claim requires a modified T cell that results 10 from a single step modification, i.e., where a CAR sequence is integrated 11 specifically into the TCRα gene such that it is inactivated. (Jantz Motion 3, Paper 12 96, 3:8-14; 20:16-21:2; Fry Declaration, Ex. 2003, ¶¶ 68, 73, 96). Jantz 13 acknowledges that the ’629 specification discloses inactivating four genes, of 14 which the TCRα gene is one option, including by HR. However, Jantz argues the 15 specification does not describe using a CAR for this purpose but only a general and 16 undisclosed sequence. (Jantz Motion 3, Paper 96, 21:15-23:3). 17 Jantz urges that, when discussing CAR introduction, the ’629 specification 18 discloses two T cell modification steps, one to inactivate the TCRα and a second 19 and separate step, occurring either before or after the first step, to introduce another 20 sequence, e.g., a CAR sequence, either transiently by mRNA or by pseudo-random 21 integration by lentiviral vector (LV). (Jantz Motion 3, Paper 96, 24:9-17, citing 22 ’629 Application, Ex. 2004, Figure 5, ¶¶ 268, 301, 202, 203; Fry Declaration, 23 Ex. 2003, ¶107). 24 13 Sather, B.D. et al., Efficient modification of CCR5 in primary human hematopoietic cells using a megaTAL nuclease and AAV donor template. Science Translational Medicine, Vol 7, Iss. 307, pp. 307 (September 2015). (Ex. 2022). Interference 106,118 14 Jantz points to Figure 5 of the ’629 specification, reproduced below, as 1 illustrating both the genetic modification step where a TCR gene is inactivated and 2 the additional genomic modification step where CAR is introduced. 3 4 5 Above is shown Figure 5 of the ’629 disclosure. 6 7 As Jantz points out, the five steps of Figure 5 include: (1) “providing T 8 cells,” (2) “a) Transducing said cells with pTalpha … b) Transducing said cells 9 with multi-chain CARs,” (3) “[e]ngineering non alloreactive and 10 immunosuppressive resistant T cells [by] … [inactivating] TCR alpha in said cells 11 to eliminate the TCR from the surface of the cell…,” and inactivating CD52 to 12 create immunosuppressive resistance (4) “[e]xpansion in vitro, and 13 (5) “[o]ptionally expos[ing] said cells with bispecific antibodies in vivo following 14 administration to a patient.” (Jantz Motion 3, Paper 96, 9:4-11, citing, 15 ’629 specification, Ex. 2004 ¶¶ 200-209; Fry Declaration, Ex. 2003 ¶ 64). 16 As Jantz notes, the genetic modification step is shown as step 3, and 17 includes inactivation of existing genes where one “X” gene (TCRα) and one “Y” 18 gene (CD52) are inactivated by using rare-cutting endonucleases (TALE-19 Interference 106,118 15 nucleases) to cleave the genes. Jantz points out that an exogenous polynucleotide 1 is not provided in the step, and the inactivation occurs not by HR, but by non-2 homologous end joining (“NHEJ”), said to be an error-prone cellular repair 3 pathway that results in the insertion or deletion of nucleotides at the cleaved site. 4 (Jantz Motion 3, Paper 96, 10:1-9, citing, ’629 specification, Ex. 2004 ¶¶ 204-207; 5 Fry Declaration, Ex. 2003 ¶ 61-65). Dr. Fry testified that NHEJ is incapable of 6 integrating sequences, such as CAR, into a genome. (Fry Declaration, Ex. 2003 7 ¶ 120). 8 Jantz points to the additional genomic modification step as being shown in 9 step 2, and as including the introduction of new genes where a CAR sequence and 10 pTα sequence are introduced by way of “transduction” with lentiviral vectors that 11 randomly integrate the new genes into the genome. Jantz notes that the 12 specification states that CAR transduction can be “before or after” TCRα and 13 CD52 inactivation and is identified as an “additional genomic modification step,” 14 and shown as a separate step that does not occur simultaneously with “the genetic 15 modification step.” (Jantz Motion 3, Paper 96, 10:10-16, citing, ’629 specification, 16 Ex. 2004 ¶¶ 202, 203; Fry Declaration, Ex. 2003 ¶ 64, 66, 68). 17 Jantz addresses those portions of the ’629 specification that Galetto argued, 18 during ex parte prosecution, support the contested limitation. In particular, Galetto 19 argued that paragraphs 103 and 124 of the ’629 specification, when considered 20 together, provide written description support for this limitation. 21 22 Paragraphs 103 and 124 23 We reproduce paragraph 103 below and include the preceding paragraphs 24 for context. 25 [0100] By additional genomic modification step, can be 26 intended also the inactivation of another gene selected from the group 27 Interference 106,118 16 consisting of CD52, GR, TCR alpha and TCR beta. [sic] As 1 mentioned above, said additional genomic modification step can be an 2 inactivation step comprising: 3 [0101] (a) introducing into said cells at least one rare-cutting 4 endonuclease such that said rare-cutting endonuclease specifically 5 catalyzes cleavage in one targeted sequence of the genome of said 6 cell. 7 [0102] (b) Optionally introducing into said cells a exogenous 8 nucleic acid successively comprising a first region of homology to 9 sequences upstream of said cleavage, a sequence to be inserted in the 10 genome of said cell and a second region of homology to sequences 11 downstream of said cleavage, 12 wherein said introduced exogenous nucleic acid inactivates a 13 gene and integrates at least one exogenous polynucleotide sequence 14 encoding at least one recombinant protein of interest. In another 15 embodiment, said exogenous polynucleotide sequence is integrated 16 within a gene selected from the group consisting of CD52, GR, TCR 17 alpha and TCR beta. 18 19 [0103] In particular embodiment said method to engineer cell 20 further comprises an additional genomic modification step. By 21 additional genomic modification step, can be intended the 22 introduction into cells to engineer of one protein of interest. [sic] Said 23 protein of interest can be, as non limiting examples, pTalpha or 24 functional variant thereof, a Chimeric Antigen Receptor (CAR), a 25 multi-chain CAR, a bispecific antibody or rare-cutting endonuclease 26 targeting PDCD1 or CTLA-4 as described in the present disclosure. 27 28 (’629 specification, Ex. 2004, ¶¶100-103, emphasis added). 29 30 Paragraph 103 of the ’629 specification refers to a method that “further 31 comprises an additional genomic modification step” in engineering a T cell. 32 (’629 Application, Ex. 2004 ¶ 103; Fry Declaration, Ex. 2003 ¶ 101). This 33 Interference 106,118 17 paragraph does not describe integrating a CAR as the exogenous nucleic acid in the 1 process described at paragraphs 100-102 but indicates that a CAR sequence, for 2 example, may be introduced in a further additional step. Nor does the paragraph 3 specify that the listed proteins of interest in paragraph 103 are integrated by HR, or 4 other method, into the TCRα gene of the already modified T cell. Thus, we agree 5 with Dr. Fry that “the generic recitation in ¶ 103 of ‘the introduction[14] into cells to 6 engineer of one protein of interest’ without any additional blaze marks does not 7 fairly suggest to a POSA that any of the listed ‘proteins of interest’ should be 8 specifically integrated into any gene, let alone the TCRα gene.” (Fry Declaration, 9 Ex. 2003, ¶¶ 102-108). 10 Further, while Jantz acknowledges that paragraph 103 includes a CAR as a 11 “protein of interest”, Jantz urges that one skilled in the art would not have 12 considered the list of proteins of interest listed in paragraph 103 to be a list 13 intended for genomic integration and thus are not “interchangeable” in any method 14 of using HR disclosed by the ’629 specification, e.g., at paragraph 102. As an 15 example, Jantz asserts, one skilled in the art would not integrate the listed “rare-16 cutting endonuclease” because its purpose is to be transiently expressed to 17 inactivate another gene and doing so would cause the nuclease to be permanently 18 expressed, causing toxicity from off-target cleavage. (Jantz Motion 3, Paper 96, 19 16:10-15, citing Fry Declaration, Ex. 2003 ¶ 108). 20 Paragraph 124 is found within a separate section of the ’629 specification 21 having the heading “Pre-Talpha”. We reproduce paragraph 124 below and include 22 the preceding paragraphs for context: 23 14 Dr. Fry testified that “introduction” is a broad term that include more than a dozen different methods of expressing a protein in a cell, many of which are incompatible with integration into the genome by HR. (Fry Declaration, Ex. 2003 ¶¶ 102-103). Interference 106,118 18 [0119] In another aspect, the invention relates to a method of expanding 1 TCR alpha deficient T-cell comprising introducing into said T-cell 2 pTalpha (also named preTCR.alpha.) or a functional variant thereof and 3 expanding said cells, optionally through stimulation of the CD3 4 complex. In a preferred embodiment, the method comprises: 5 [0120] a) Transforming said cells with nucleic acid encoding at 6 least a fragment of pTalpha to support CD3 surface expression 7 [0121] b) Expressing said pTalpha into said cells 8 [0122] c) Expanding said cells optionally, optionally through 9 stimulation of the CD3 complex. 10 11 [0123] The invention also relates to a method of preparing T-cells for 12 immunotherapy comprising steps of the method for expansion for T-cell. 13 14 [0124] In particular embodiment, the pTalpha polynucleotide sequence 15 can be introduced randomly or else through homologous recombination, 16 17 in particular the insertion could be associated with the inactivation of the 18 TCRalpha gene. 19 20 (’629 Application, Ex. 2004, ¶119-124). 21 Paragraph 124 states that pTα may be introduced into TCRα deficient cells 22 “randomly or else through homologous recombination.” Paragraph 124 mentions 23 HR but does not mention CAR or otherwise expressly describe integration of a 24 CAR into the TCRα. 25 As Jantz notes paragraph 124 falls within a broader section of the 26 specification that relates to a method of restoring the expansion capability of TCRα 27 deficient T cells. (’629 Application, Ex. 2004 ¶¶ 119-133; Fry Declaration, 28 Ex. 2003 ¶ 110). 29 According to Jantz inactivating TCRα in T cells eliminates a means of 30 stimulating T cell expansion and the ’629 specification discloses the introduction 31 of the pTα sequence randomly or else through homologous recombination in order 32 Interference 106,118 19 to restore the ability to expand. In particular, according to Jantz, when pTα is 1 introduced to T cells with an inactivated TCRα gene, it combines with the existing 2 TCRβ to form a pre-TCR complex which restores the ability to expand the T cells. 3 Jantz notes that the ’629 specification mentions only pTα as being able to 4 accomplish the goal of restoring expansion. Thus, argues Jantz, Galetto’s 5 argument during ex parte prosecution that “the skilled artisan would immediately 6 recognize that a CAR and pTα are two interchangeable species of a ‘protein of 7 interest’ that …can be introduced as an exogenous nucleic acid that integrates and 8 inactivates TCR alpha” is incorrect because a CAR will not enable the formation of 9 pre-TCR complex in TCRα deficient T cells to restore the ability of T cells to 10 expand, the purpose of introducing pTα.” (Jantz Motion 3, Paper 96, 17:9-18:6, 11 citing Fry Declaration, Ex. 2003 ¶¶ 110-112; Galetto Amendment and Response, 12 Ex. 2020, 7, 8). 13 Jantz further notes that paragraph 124 states that the pTα insertion is “in 14 association with” inactivation of TCRα, but argues that “in association with” 15 would be read by one skilled in the art as requiring insertion of pTα anywhere in 16 order to remedy the deficiency associated with inactivating TCRα. Jantz notes that 17 this understanding is consistent with paragraph 129, which describes several 18 examples of how to create “TCR alpha deficient cells”, none of which requires 19 integrating pTα specifically into TCRα, or refer to HR. (Jantz Motion 3, Paper 96, 20 18:7-15, citing Fry Declaration, Ex. 2003, ¶¶ 113-117). 21 Jantz argues that for this reason one skilled in the art would not have been 22 guided to select CAR from the list found in paragraph 103 and substitute it for the 23 pTα in paragraph 124 to arrive at the claimed invention. Jantz argues that 24 Galetto’s arguments before the Examiner improperly relied upon an obviousness 25 rationale, i.e., that it would have been obvious to integrate CAR into TCRα by HR 26 Interference 106,118 20 given paragraphs 103 and 124. (Jantz Motion 3, Paper 96, 18:18-19:1; 20:3-8 1 citing Lockwood v. Am. Airlines, Inc., 107 F.3d 1565, 1572 (Fed. Cir. 1997)).15 2 3 ’629 specification 4 Jantz argues that the ’629 specification considered in its entirety fails to 5 describe integrating a CAR sequence by HR into the TCRα gene either when 6 discussing CARs specifically, or when CARs are in a list of proteins of interest. 7 Jantz Motion 3, Paper 96, 20:11-13, citing Fry Declaration, Ex. 2003 ¶¶ 118-119). 8 Jantz points out that when the ’629 specification discusses CARs specifically and 9 not within a list, it consistently describes introducing CARs before or after, but not 10 simultaneous with, the step of inactivating genes such as the TCRα gene. (Jantz 11 Motion 3, Paper 96, 20:16-21, citing ’629 Application, Ex. 2004, ¶¶ 203, 268; Fry 12 Declaration, Ex. 2003 ¶¶ 104-106). 13 Jantz argues that CAR introduction methods, including transient expression 14 of a CAR sequence via electroporation of mRNA or random integration of a CAR 15 sequence via lentiviral transduction, do not inactivate a TCRα gene and thus are 16 described as occurring either before or after such inactivation is caused by some 17 other process. (Jantz Motion 3, Paper 96, 20:21-25, citing ’629 Application, 18 Ex. 2004, ¶¶ 163, 220, 301; Fry Declaration, Ex. 2003 ¶¶ 104-106). Jantz argues 19 that since the ’629 specification discloses introducing a CAR “before or after” 20 inactivation and does not use the term “during”, a person skilled in the art would 21 have understood that it was not in possession of a single genetic modification step 22 that would result in T cells having the contested limitation. 23 15 Jantz does not agree that the invention found in Galetto involved claims would have been obvious in view the ’629 specification. (Jantz Motion 3, Paper 96, 18:18-20) Interference 106,118 21 As pointed out by Jantz, the ’629 disclosure provides two illustrations of 1 introducing a CAR to a T cell and both use transient introduction of a CAR 2 sequence, not HR. (Jantz Motion 3, Paper 96, 24:9-15). One is shown at Figure 5, 3 discussed above, and the other at Figure 2. Figure 2 is reproduced below. 4 5 6 Above is shown Figure 2 of the ’629 disclosure. 7 8 Figure 2 is identified in the ’629 specification as a “[s]chematic 9 representation of the genetically modified therapeutic T-cells according to the 10 invention and the patient's tumor cells.” (’629 Application, Ex. 2004, ¶ 25). Jantz 11 urges that “[t]he core concept of the invention is shown in Figure 2, which depicts 12 the use of rare-cutting endonucleases called TALENs or TALE-nucleases to cut an 13 “X” gene that is “disrupted for non-alloreactivity” (eliminating alloreactivity or 14 GvHD associated with a donor’s TCR) and a “Y” gene that is “disrupted for non-15 toxic engraftment” (increasing resistance to immunosuppressive drugs used to 16 deplete host T cells)”. (Jantz Motion 3, Paper 96, 7:19-24, citing ‘629 Application, 17 Ex. 2004 ¶21, 192, Fig. 2). According to Jantz, the ’629 specification discloses 18 “inactivating an “X” gene and a “Y” gene as “the genetic modification step” and 19 identifies TCRα as one of four “X” genes and CD52 as one of two “Y” genes, that 20 can be inactivated by use of the TALEN by HR or NHEJ. (’629 specification, 21 Interference 106,118 22 Ex. 2004 ¶¶ 68-99; Fry Declaration, Ex. 2003 ¶ 61). Jantz asserts that the CAR 1 shown in Figure 2 is introduced in a separate, optional “additional genomic 2 modification step”, not through the use of HR, and after the T cell has been 3 modified. (Jantz Motion 3, Paper 96, 8:8-8:14). 4 Dr. Fry testified that the method shown in the two working examples of 5 introducing a CAR into a T cell use mRNA which results only in transient 6 introduction of the CAR and cannot integrate the CAR sequence into TCRα gene 7 to cause TCR inactivation. (Jantz Motion 3, Paper 96, 24:9-17; Fry Declaration, 8 Ex. 2003, ¶¶ 38, 105,107; ’629 Application, Ex. 2004 ¶¶ 268, 301). While an 9 applicant need not provide an example to have written description, an example 10 may indicate possession of the claimed invention. Falkner v. Inglis, 448 F.3d 11 1357, 1366 (Fed. Cir. 2006). We agree with Jantz that these working examples, 12 considered in view of the explanation and context of the ’629 specification, do not 13 show possession of the contested limitation. 14 As noted above, claim 33 differs from the other claims because it does not 15 contain language requiring integration of the CAR polynucleotide to be by HR. 16 Like the other Galetto involved claims, claim 33 requires that the CAR 17 polynucleotide be integrated into the TCRα gene specifically. Jantz argues, and 18 Dr. Fry testified, that the ’629 specification does not describe the integration into 19 the TCRα gene specifically. Jantz argues, and Dr. Fry’s testimony supports the 20 argument, that the only methods disclosed in the ’629 specification for introduction 21 of a CAR specifically cannot result in integration of a CAR into a TCRα gene. 22 (Jantz Motion 3, Paper 96, 24:9-17, citing Fry Declaration, Ex. 2003, ¶¶ 38, 23 105,107; ’629 Application, ¶¶ 202-203, 268, 301). 24 Jantz argues that, for the reasons it provides, and as in Novozymes, the 25 ’629 specification provides insufficient “blaze marks” because it “provide[s] 26 formal textual support for each individual limitation recited in the claims [at 27 Interference 106,118 23 issue],” but “never presented [those limitations] together.” (Jantz Motion 3, 1 Paper 96, 19:6-17, citing Novozymes, 723 F.3d at 341). 2 3 Galetto Opposition. 4 In its Opposition 3, Galetto argues that the ’629 specification identifies CAR 5 as a particular protein of interest and one skilled in the art would have understood 6 that CAR could have been used as an exogenous nucleotide in a single genetic 7 modification step to arrive at the claimed T cells. As Galetto notes, Jantz does not 8 dispute that the ’629 specification discloses T cells having an inactivated TCRα 9 gene nor that the ’629 specification describes introduction of DNA encoding a 10 CAR into these modified T cells. Jantz also agrees that CAR is said to be 11 generally “a protein of interest” in portions of the ’629 specification. (Jantz 12 Reply 3, Paper 193, 1:22-2:23; citing Fry Deposition, Ex. 1040, 22:22-23:13, 13 65:23-66:3). Galetto argues that, in view of these disclosures and within the 14 context of the entire ’629 specification, the necessary blaze marks would have 15 guided one skilled in the art to the claimed invention. 16 In support of its position, Galetto directs us to the testimony of Dr. Mark 17 Osborn. We have reviewed Dr. Osborn’s credentials and find Dr. Osborn qualified 18 to testify regarding the technical issues discussed in his testimony. (Osborn 19 Declaration, Ex. 1041; Osborn Curriculum vitae. Ex. 1043). 20 Dr. Osborn testified that “[s]ince polynucleotides encoding a CAR are 21 described in the Galetto application, the skilled artisan would have further 22 understood that the integration of a polynucleotide encoding a CAR into TCRα by 23 homologous recombination could inactivate the TCRα gene.” (Osborn Declaration, 24 Ex. 1041, ¶ 63). Even accepting this testimony, a description in the 25 ’629 specification of a polynucleotide encoding CAR does not amount to 26 description sufficient to show possession of the claimed modified T cells. 27 Interference 106,118 24 Dr. Osborn’s testimony on this point may be relevant to obviousness under 1 35 U.S.C. § 103 in that it addresses what one skilled in the art might be motivated 2 to do or try in view of the ’629 specification. Dr. Osborn agreed that it is his 3 opinion that it would have been obvious how to get to a disclosure of a CAR 4 integrated into the TCRα from reading the ’629 specification. (Osborn Deposition, 5 Ex. 2070, 132:18-134:5-14). However, obviousness is not the issue before us. 6 Lockwood, 107 F.3d at 1571–72. 7 We turn to the specific portions of the ’629 specification that Galetto argues 8 support the Galetto involved claims and in particular the contested limitation. 9 As we discussed above the proteins of interest recited in paragraph 103 are 10 recited only in connection with the further “additional genomic modification step” 11 in which a protein is introduced into the modified cell, but not in connection with 12 inactivating the TCRα gene as described in paragraph 102. Regarding 13 paragraph 103, Dr. Osborn asserts there are known techniques for accomplishing 14 simultaneous inactivation and modification, but agrees that paragraph 103 15 describes a separate action from the inactivation described in paragraph 102. 16 (Osborn Deposition, Ex. 2070, 168:12-169:11). 17 Both Dr. Fry and Dr. Osborn seem to agree that the proteins of interest listed 18 in paragraph 103, which include rare-cutting endonucleases, are of a different 19 character than the exogenous nucleic acid to be integrated into the T cell genome 20 referred to in paragraph 102. For example, Dr. Osborn’s testimony indicates that 21 he considers inactivation of PDCD1 or CTLA-4 to be genomic modifications 22 intended in paragraph 103 and that the listed rare-cutting endonucleases are the 23 means for producing those genomic modifications, and they do so without 24 integration. (Osborn Deposition, Ex. 2070, 103:14-109:20). Dr. Fry and 25 Dr. Osborn also seem to also agree that integrating a rare-cutting endonuclease into 26 the genome would not be logical given its function. (See, e.g., Fry Declaration, 27 Interference 106,118 25 Ex. 2003, ¶ 108; Fry Deposition, Ex. 1040, 61:8-62:24, 65:23-66:3 (“The proteins 1 of interest that are included in the description of 103 include the rare cutting 2 endonuclease, and it would be, in my opinion, an odd protein that one would want 3 to stably introduce into a cell.”); Osborn Deposition, Ex. 2070, 46:2-7 (“So the 4 specific question is, why don't you integrate an endonuclease into a cell? ... I think 5 that, depending on specificity, you would have a potential concern for any off-6 target activity”) and 108:16-109:20). 7 Based on the evidence before us, we agree with Jantz that one skilled in the 8 art would have known not to integrate a rare-cutting endonucleases to inactivate 9 the TCRα gene because these enzymes could continue their cutting function 10 increasing the risk of off-target cutting. (Jantz Motion 3, Paper 96, 23:12-24:6). It 11 follows that one skilled in the art would not have understood the unidentified 12 proteins or sequences of interest of paragraph 102, as well as those similarly 13 discussed in paragraphs 98, 99 and 118, to be the same proteins of interest listed in 14 paragraph 103 which includes, inter alia, rare-cutting endonucleases. 15 Turning to paragraph 124, pTα is the only protein described as useful for the 16 expansion method found in paragraph 124. Galetto does not direct us to 17 convincing evidence or argument that one skilled in the art would have understood 18 CAR to be an appropriate substitution for pTα that is used for the expansion 19 method or that the paragraph 124 describes integrating pTα specifically into the 20 TCRα gene. (Galetto Opposition 3, Paper 176, 7:21-8:22; 9:3-13). Thus, we agree 21 with Jantz that this portion of the ’629 considered in the context of the 22 ’629 specification as a whole, does not describe the contested limitation. 23 Galetto points to other portions of the ’629 specification that it urges would 24 have guided one skilled in the art to the claimed invention, including portions at 25 paragraphs 98, 99, and 118. (Galetto Opposition 3, Paper 176, 9:3-13; 10:8-11:14, 26 citing Osborn Declaration, Ex. 1041, ¶¶ 57-64). Each portion discloses 27 Interference 106,118 26 inactivating any one of four genes by HR, including TCRα, but does not identify 1 what exogenous sequence is to be used to affect inactivation. Galetto argues that 2 these portions encompass the possibility of “knock-ins” of the TCRα gene, i.e., the 3 introduction of new sequences or genes of interest. What is lacking though is 4 guidance to select CAR as the sequence for the “knock-in” (’629 specification, 5 Ex. 2004, ¶¶ 98, 99, 103, 118). We agree with Jantz that the ’629 specification 6 “never presented [the limitations of Galetto’s involved claims] together in any 7 particular embodiment,” nor did the application provide sufficient “blaze marks” to 8 guide one toward the claimed combination among a “slew of competing 9 possibilities.” (Jantz Reply 3, Paper 193, 8:8-16, citing Novozymes, 723 F.3d at 10 1351). 11 Galetto argues, and Dr. Osborn testified, that the ’629 specification provides 12 “blaze marks [that] point directly to a CAR as a protein of interest for introduction 13 into a TCRα-inactivated cell”, citing for example, Figures 2 and 5 (Galetto 14 Opposition 3, Paper 176, 9:21-22, 17:10-18:8, citing Osborn Declaration, Ex 1041, 15 ¶¶ 50-54). As discussed above, these Figures, while showing CAR as a protein of 16 interest, further support that the CAR sequence is introduced in a step separate, 17 either before or after, TCRα is inactivated. Dr. Osborn agreed that “introduction” 18 of CAR within the ’629 specification could point to introduction of the CAR 19 sequence into TCRα that was already inactivated. (Osborn Deposition, Ex. 2070, 20 163:8-17; 90:20-91:5, 93:18-94:6). Dr. Fry, while acknowledging CAR as a 21 protein of interest, testified that the ’629 specification did not suggest a CAR 22 sequence integrated into the TCRα gene. (Fry Deposition, Ex. 1040, 22:22-23:13, 23 65:23-66:3). 24 The description of introducing a CAR “before or after” TCRα inactivation in 25 relation to the Figures, as discussed above, would not lead one toward integrating a 26 CAR sequence “during” TCRα inactivation. Thus these Figures, in the context and 27 Interference 106,118 27 explanation provided by the ’629 specification, do not describe the contested 1 limitation. 2 Galetto argues that “nowhere does Galetto’s application indicate that [HR] 3 should NOT be used with a CAR.” (Galetto Opposition 3, Paper 176, 11:15-12:2. 4 We do not find this argument convincing. Galetto does not explain, and it is not 5 apparent to us, why one skilled in the art would have “immediately discerned” that 6 HR was to be used simply because Galetto did not expressly exclude the method. 7 Galetto argues that the portion of the ’629 specification found at 8 paragraphs 219 and 220 disclose non-integrative lentiviral vectors that could 9 integrate into a genome through HR. (Galetto Opposition, Paper 176, 11:15-10 12:21). Dr. Osborn concedes though that paragraph 219 does not disclose 11 integrating a CAR into TCRα gene. (Osborn Deposition, Ex. 2070, 189:10-190:7). 12 As Jantz notes, the only methods disclosed in the ’629 specification for 13 introduction of a CAR specifically cannot result in integration of CAR into a 14 TCRα gene. (Jantz Motion 3, Paper 96, 24:9-17, citing Fry Declaration, Ex. 2003, 15 ¶¶ 38, 105,107; ’629 Application, ¶¶ 202-203, 268, 301). Accordingly, we do not 16 find these portions, when considered in the context of the ’629 specification as a 17 whole, to describe integrating a CAR into the TCRα gene as required by the 18 Galetto involved claims. 19 Galetto does not separately present arguments directed to either independent 20 claim 32 or 33. Like the other involved Galetto claims, both claims 32 and 33 21 require integrating a CAR into the TCRα gene specifically. Claim 32 contains 22 language specifying that integration is through HR but claim 33 does not. Jantz 23 argues that the ‘629 specification “never discloses or suggests- [] any description 24 of a CAR sequence integrated specifically into the TCRα gene.” (Jantz Reply 3, 25 Paper 193, 2:6-7). Dr. Fry testified that none of the ’629 methods where CAR 26 introduction is discussed specifically would result in the required specific 27 Interference 106,118 28 integration. (Jantz Motion 3, Paper 96, 24:9-17, citing Fry Declaration, Ex. 2003, 1 ¶¶ 38, 105, 107; ’629 Application, ¶¶ 202-203, 268, 301). Galetto does not dispute 2 that these methods would not result in the specific integration required by its 3 claims. We agree with Jantz that the requirement for specific integration, found in 4 both claims 32 and 33, is not described. 5 Galetto argues that Dr. Fry came to the “wrong conclusion” because he did 6 not know the legal significance of the phrase “blaze marks.” (Galetto Opposition 3, 7 Paper 176, 16:7-22, citing Fry Deposition, Ex. 1040, 59:14-23). Galetto does not 8 contend that Dr. Fry’s testimony is based on a misunderstanding of the law, or 9 otherwise explain why we should not credit his testimony based on his 10 unfamiliarity with this particular phrase. Dr. Fry’s testimony indicates that he 11 based his testimony upon an adequate understanding of the written description 12 issue. (Fry Declaration, Ex. 2003, ¶¶ 22-25). 13 As Galetto notes, Jantz points to references by a Galetto inventor to Jantz’s 14 work of “inactivating the TCRα gene by integrating a CAR sequence by HR into 15 that gene” in a Galetto patent application as well as a scientific article. Jantz argues 16 that this crediting of Jantz amounts to an acknowledgement that Jantz was the first 17 to invent the claimed subject matter. (Jantz Motion 3, Paper 96, 12:1-22). We 18 agree with Galetto though that these references to Jantz’s work have no bearing on 19 whether Galetto’s involved application provides adequate written description. 20 (Galetto Opposition 3, Paper 176, 18:18-19:4). 21 We find that Jantz has met its burden of showing a lack of written 22 description for the contested limitation. We note that much of the testimony before 23 us is in agreement. The disagreement appears to lie, primarily, in whether the 24 ’629 specification provided sufficient guidance or blaze marks to direct one 25 skilled in the art to what is claimed. Here, where there is conflict between 26 Dr. Fry’s and Dr. Osborn’s testimony, we credit the testimony of Dr. Fry over that 27 Interference 106,118 29 of Dr. Osborn. We find that the testimony of the latter relies more on what the 1 ’629 application might have suggested to one skilled in the art than what was 2 conveyed to have been in the possession of the inventors, and give it less weight 3 accordingly. 4 The evidence before us is convincing to show that one skilled in the art 5 would have understood the ’629 specification to disclose CAR introduction as a 6 “further” additional step that occurs separate from the TCR inactivation step. 7 While it could have done so, the ’629 specification does not identify the exogenous 8 nucleic acid sequence that may be used in the inactivation step as a CAR instead 9 only identifying CAR specifically as one option to be used in further modifying 10 T cells where the TCRα or other gene has already been, or later would be, 11 inactivated. The individual components of the limitation can be found within the 12 ’629 specification and one may have been able to piece together what is now 13 claimed but lacking is sufficient guidance to show that the inventors possessed 14 what is claimed. “Were we to extend Ruschig 's metaphor to this case, we would 15 say that it is easy to bypass a tree in the forest, even one that lies close to the trail, 16 unless the point at which one must leave the trail to find the tree is well marked.” 17 Fujikawa v. Wattanasin, 93 F.3d 1559, 1571 (Fed. Cir. 1996). 18 In a separate portion of its Motion 3, Jantz argues that the Galetto claim is 19 unpatententable “for the independent reason that the ’629 Application does not 20 teach a POSA how to integrate a CAR sequence into the TCRα gene.” (Jantz 21 Motion 3, Paper 96, 25:4-21). 22 Galetto relies upon the testimony of Dr. Pietro Genovese16 only in the 23 portion of its briefing addressing this argument. (Galetto Opposition 3, Paper 176, 24 16 We have reviewed Dr. Genovese’s credentials and find Dr. Genovese qualified to testify regarding the technical issues discussed in his testimony. Interference 106,118 30 21:25-25:2, citing Genovese Declaration, Ex. 1042; Genvoves Curriculum Vitae. 1 Ex. 1044). As explained below, we do not find it necessary to consider this 2 argument or to consider Dr. Genovese’s testimony addressing it to decide the 3 motion before us. However, we have considered Dr. Genovese’s testimony to the 4 extent it is relevant to the predictability of the technology involved. Dr. Genovese 5 testified that it is his opinion that, e.g., vectors and methods provided by 6 experimental results known in the art could readily be modified for inserting a 7 CAR to an endogenous TCR gene. (Genovese Declaration, Ex. 1042, ¶ 33). 8 As we noted above, Dr. Fry testified that “T cell gene editing for 9 immunotherapy remains a highly unpredictable field.” (Fry Declaration, Ex. 2003, 10 ¶¶ 127, 128). Dr. Fry later modified his testimony to acknowledge that 11 investigators had achieved targeted integration in T cells earlier than his initial 12 testimony had indicated. (Galetto Opposition 3, Paper 176, 20:27-36, citing Fry 13 Deposition, Ex. 1040, 66:12-67:2). Dr. Fry went on to testify that, while there was 14 mention of integrating into T cells in some earlier publications, this fact “certainly 15 does not change the challenges associated with modifying primary cells” and did 16 not change his opinion regarding written description. (Fry Deposition, Ex. 1040, 17 67:14-68:8). 18 As discussed above we find that the ’629 specification does not describe the 19 integration of a CAR sequence into the TCRα gene. Accordingly we need not, and 20 do not, consider this “independent reason.” Further our decision would not change 21 even accepting Galetto’s position that “[w]hen the scientific and technological 22 knowledge available at that time is appropriately considered, the POSA would 23 have known how to integrate a CAR sequence into the TCRα gene by HR”, since 24 we find that the claimed invention does not appear in the specification regardless 25 of whether one of skill in the art could make the claimed invention. (Galetto 26 Opposition 3, Paper 176, 19:18-20) Ariad Pharms., Inc. v. Eli Lilly & Co., 598 27 Interference 106,118 31 F.3d at 1348 ( “In either case the analysis compares the claims with the invention 1 disclosed in the specification, and if the claimed invention does not appear in the 2 specification….the claim…fails regardless whether one of skill in the art could 3 make or use the claimed invention.”) 4 We GRANT Jantz Motion 3. 5 As noted above, Jantz Motion 3 presents a threshold issue under Bd. R. 201. 6 Because we grant Jantz Motion 3 and find the Galetto claim to lack written 7 description support, Galetto lacks standing to continue in this interference. 8 9 B. Remaining Motions 10 Jantz filed two additional motions as did Galetto. 11 Jantz Motion 2 challenges the benefit accorded to Galetto in the declaration 12 of the interference. (Jantz Motion 2, Paper 95). Jantz also filed a miscellaneous 13 motion seeking exclusion of certain evidence. (Jantz Motion 5, Paper 204). 14 Galetto Motion 1 seeks judgment against Jantz on the basis that all the 15 involved Jantz claims are unpatentable for failure to comply with the written 16 description requirement of the first paragraph of 35 U.S.C. §112. (Galetto 17 Motion 1, Paper 24). Galetto Motion 2 seeks judgment against Jantz on the basis 18 that all the involved Jantz claims are unpatentable for failure to comply with the 19 second first paragraph of 35 U.S.C. §112. (Galetto Motion 2, Paper 25). 20 21 1. Galetto Motion 1 22 Galetto argues that we also should consider its Motion 1 as a threshold 23 motion. (Galetto Motion 1, Paper 24, 1:20-23). Galetto Motion 1 seeks judgment 24 against Jantz on the basis that the Jantz claims lack written description support. 25 A threshold issue is an issue that, if resolved in favor of the movant, would 26 deprive the opponent of standing in the interference. Threshold issues may 27 Interference 106,118 32 include, but are not expressly limited to, “in the case of an involved application 1 claim first made after the publication of the movant’s application or the movant’s 2 patent…..unpatentability for lack of written description under 35 U.S.C. 112(a) of 3 the involved application claim where the applicant suggested, or could have 4 suggested, an interference under” Bd. R. 202(a). Bd. R. 201.17 Addressing this 5 threshold issue requires a determination of whether a party presenting a claim that 6 interferes with a claim of an already published application or patent has adequate 7 basis to challenge priority of invention, a question that turns on whether that 8 party’s specification adequately supports subject matter that was first claimed by 9 another party. Cf. Agilent Techs., Inc. v. Affymetrix, Inc, 567 F.3d at 1375 (Fed. 10 Cir. 2009), citing Rowe v. Dror, 112 F.3d 474, 479 (Fed. Cir. 1997). 11 Galetto concedes that its Motion 1 does not “directly fall[] within the 12 explicitly described ‘threshold issues,’” of Bd. R. 201. However, Galetto urges 13 that its motion “should be included with such issues due to the pre- and post-AIA 14 status of Galetto’s application and Jantz’s involved patents, respectively”. In 15 particular, Galetto urges that Jantz could not have requested an interference due to 16 its post AIA status and, given this restriction, we should consider the Galetto 17 motion to raise a threshold issue. (Galetto Motion 1, Paper 24, 1:16-23). 18 Regardless of whether or not Jantz could have properly suggested 19 interference,18 it was Galetto that substantially copied Jantz patent claims and 20 requested the interference. Thus we consider whether Galetto had adequate 21 support for the subject matter that was first claimed by Jantz to see if Galetto has 22 17 Bd. R. 201 does not limit threshold issues to those listed. 18 It would seem that Jantz would have had no reason to do so until it was aware Galetto had presented interfering claims in the ’629 application. The ’629 application did not publish until December 20, 2018, well after all the Jantz patents had issued. Interference 106,118 33 standing to contest priority of invention. Agilent Techs, 567 F.3d at 1375 (Fed. 1 Cir. 2009). Galetto does not provide a convincing reason why Jantz, who first 2 claimed the interfering subject matter, should be deprived of standing to contest 3 priority of invention even were we to grant Galetto Motion 1. 4 Because our grant of Jantz Motion 3 deprives Galetto of standing and 5 Galetto has not shown that its Motion 1 raises a threshold issue, we do not further 6 consider Galetto Motion 1. We DISMISS as moot Galetto Motion 1. 7 8 2. Jantz Motion 2 and Galetto Motion and 2 9 Jantz Motion 2 challenges the benefit accorded to Galetto in the declaration 10 of the interference. (Jantz Motion 2, Paper 95). Galetto Motion 2 seeks judgment 11 against Jantz on the basis that all the involved Jantz claims are unpatentable for 12 failure to comply with the second first paragraph of 35 U.S.C. §112. (Galetto 13 Motion 2, Paper 25). 14 Because we grant Jantz Motion 3 and find the Galetto involved claims to 15 lack written description support, Galetto lacks standing to continue in this 16 interference. Bd. R. 201. We need not, and do not, consider Jantz Motion 2 or 17 Galetto Motion 2. 18 We DISMISS these motions as moot. 19 20 3. Jantz Motion 5 21 In its Motion 5, Jantz moves to exclude certain testimonial evidence Galetto 22 relies upon in Galetto Motions 1 and 2. (Jantz Motion 5, Paper 204). Because we 23 need not, and do not, consider Galetto Motions 1 and 2, we need not, and do not, 24 consider Jantz Motion 5 nor the evidence cited in the motion. 25 We DISMISS Jantz Motion 5 as moot. 26 Interference 106,118 34 C. Conclusion 1 Because we grant Jantz Motion 3 and find the Galetto claim to lack written 2 description support, Galetto lacks standing to continue in this interference. 3 Bd. R. 201. Accordingly, we enter judgment against Galetto in a separate paper 4 and do not consider, except to the extent discussed in this decision, the remaining 5 motions filed by the parties. 6 7 III. Order 8 It is 9 ORDERED that Jantz Motion 3 is GRANTED; 10 FURTHER ORDERED that Jantz Motions 1 and 5, and Galetto 11 Motions 1 and 2, are DISMISSED as moot; and 12 FURTHER ORDERED that judgment shall be entered against Galetto 13 in a separate paper. 14 15 cc (via email): Interference 106,118 35 Attorney for Jantz: Edward R. Gates Michael J. Twomey Eric P. Greenwald WOLF, GREENFIELD & SACKS, P.C. egates-ptab@wolfgreenfield.com michael.twomey@wolfgreenfield.com eric.greenwald@wolfgreenfield.com Attorney for Galetto: Salvatore J. Arrigo Scott M. K. Lee Harry J. Guttman ARRIGO, LEE, GUTTMAN & MOUTA-BELLUM LLP sal@arrigo.us scott.lee@arrigo.us harry@arrigo.us Copy with citationCopy as parenthetical citation
