Ex Parte Pierik et al

Patent Trial and Appeal Board

Aug 28, 2018

13121195 (P.T.A.B. Aug. 28, 2018)

UNITED STA TES p A TENT AND TRADEMARK OFFICE
APPLICATION NO. FILING DATE FIRST NAMED INVENTOR
13/121, 195 03/28/2011 Anke Pierik
24737 7590 08/30/2018
PHILIPS INTELLECTUAL PROPERTY & STANDARDS
465 Columbus A venue
Suite 340
Valhalla, NY 10595
UNITED STATES DEPARTMENT OF COMMERCE
United States Patent and Trademark Office
Address: COMMISSIONER FOR PATENTS
P.O. Box 1450
Alexandria, Virginia 22313-1450
www .uspto.gov
ATTORNEY DOCKET NO. CONFIRMATION NO.
2008P01150WOUS 6845
EXAMINER
FLINDERS, JEREMY C
ART UNIT PAPER NUMBER
1639
NOTIFICATION DATE DELIVERY MODE
08/30/2018 ELECTRONIC
Please find below and/or attached an Office communication concerning this application or proceeding.
The time period for reply, if any, is set in the attached communication.
Notice of the Office communication was sent electronically on above-indicated "Notification Date" to the
following e-mail address(es):
patti. demichele@Philips.com
marianne.fox@philips.com
katelyn.mulroy@philips.com
PTOL-90A (Rev. 04/07)
UNITED STATES PATENT AND TRADEMARK OFFICE
BEFORE THE PATENT TRIAL AND APPEAL BOARD
Ex parte ANKE PIERIK and HENDRIK ROELOF ST APER T
Appeal2017-007169
Application 13/121,195
Technology Center 1600
Before JEFFREYN. FREDMAN, MICHAEL J. FITZPATRICK, and
JOHN E. SCHNEIDER, Administrative Patent Judges.
FREDMAN, Administrative Patent Judge.
DECISION ON APPEAL
This is an appeal 1,2 under 35 U.S.C. § 134 involving claims to a
method for testing nucleic acids on a support. The Examiner rejected the
claims as obvious. We have jurisdiction under 35 U.S.C. § 6(b). We affirm.
Statement of the Case
Background
"Biochips or biological microarrays ... consist of an arrayed series of
a large number of microscopic spots of nucleic acid molecules, each
1 Appellants identify the Real Party in Interest as KONINKLIJKE PHILIPS
N.V. (see App. Br. 4).
2 We have considered and herein refer to the Specification of Mar. 28, 2011
("Spec."); Final Office Action of July 7, 2016 ("Final Action"); Appeal
Brief of Dec. 2, 2016 ("App. Br."); Examiner's Answer of Feb. 7, 2017
("Answer"); and Reply Brief of Apr. 5, 2017 ("Reply Br.").
Appeal2017-007169
Application 13/121,195
containing small amounts of a specific nucleic acid sequence ... that are
used as capture probes to hybridize a cDNA or cRNA sample" (Spec. 1: 17-
22). "Capture probe-target hybridization is typically detected and quantified
by fluorescence-based detection of fluorophore-labeled targets to determine
relative abundance of nucleic acid sequences in the target" (id. 1 :23-25).
"During the manufacturing process of microarrays it is necessary to
know whether each spot on the substrate is present and can still hybridize"
(id. 3:5---6). "The present invention addresses this need and provides means
and methods which allow the immobilization and subsequent testing and
quality-controlling of nucleic acids deposited on a support" (id. 3 :20-22).
The Claims
Claims 1-18 are on appeal. Claim 1 is representative and reads as
follows:
1. A method for testing nucleic acids on a support,
comprising the steps of:
(a) immobilizing one or more nucleic acids on a solid
support via crosslinking by heat or light or via chemical
immobilization, wherein each of the immobilized nucleic acids
includes a stretch of nucleotides of only one basetype;
(b) providing a labeled oligonucleotide complementary to
the stretch of nucleotides of only one basetype, wherein said
labeled oligonucleotide is capable of forming a complex with
each of the immobilized nucleic acids at the stretch of
nucleotides of only one basetype; and
( c) determining a value indicative for the condition of said
nucleic acids via the amount of labeled oligonucleotide being in
complex with the immobilized nucleic acid.
2
Appeal2017-007169
Application 13/121,195
The Re} ections3
A. The Examiner has rejected claims 1, 5-16, and 18 under 35 U.S.C.
§ 101 as directed to an abstract idea (Ans. 7-10).
B. The Examiner has rejected claims 1-7 and 9-18 under 35 U.S.C.
§ I03(a) as obvious over Van Beuningen, 4 Khan, 5 and Peixoto6 (Ans. 2-5).
C. The Examiner has rejected claims 1-18 under 35 U.S.C. § I03(a) as
obvious over Van Beuningen, Khan, Peixoto, and Penchovsky7 (Ans. 5-7).
A. 35 U.S.C. § 1 OJ
The Examiner finds all of the claims on appeal unpatentable under 35
U.S.C. § 101 as being directed to patent-ineligible subject matter,
specifically the abstract idea of "'determining a value indicative for the
condition of ... nucleic acids' based on the observed presence or amount of
labeled oligonucleotide being in complex with said nucleic acids" (Ans. 7).
To determine whether a claim is invalid under§ 101, we employ the
two-step Alice framework. In step one, we ask whether the claims are
3 The Examiner entered a new ground of rejection under 35 U.S.C. § 101 in
the Examiner's Answer authorized by the TC Director (see Ans. 7-10, 16)
that was addressed by Appellants in the Reply Brief (see Reply Br. 5---6).
4 Van Beuningen, US 2005/0153290 Al, published July 14, 2005.
5 Khan et al., A universal reference sample derived from clone vector for
improved detection of differential gene expression, 7 BMC GENOMICS 109,
pages numbered 1-10 (2006).
6 Peixoto et al., Evaluation of reference-based two-color methods for
measurement of gene expression ratios using spotted cDNA microarrays, 7
BMC GENOMICS 35, pages numbered 1-12 (2006).
7 Penchovsky et al., End-specific covalent photo-dependent immobilization
of synthetic DNA to paramagnetic beads, 28 NUCLEIC ACIDS RES. E98,
pages numbered 1---6 (2000).
3
Appeal2017-007169
Application 13/121,195
directed to a patent ineligible concept, such as an abstract idea or law of
nature. Alice Corp. Pty. Ltd. v. CLS Bank Int'!, 134 S.Ct. 2347, 2355
(2014); Mayo Collaborative Services v. Prometheus Laboratories, Inc., 566
U.S. 66, 75-77 (2012); Ariosa Diagnostics, Inc. v. Sequenom, Inc., 788 F.3d
1371, 1375 (Fed. Cir. 2015). While method claims are generally eligible
subject matter, claims that are directed only to abstract ideas and/or natural
phenomena are directed to a patent ineligible concept. Ariosa, 788 F .3d at
1376.
Alice Step One
Claims 1 and 15 of the instant application are directed to methods of
analyzing or testing how much nucleic acid is located at a particular location
on a support by using an internal reference oligonucleotide of a "one
basetype" where hybridization of a labeled complementary oligonucleotide
will allow determination of the amount and condition of the immobilized
oligonucleotides.
Taking up the first step of the patent-eligibility analysis, we note, "[a]t
some level, 'all inventions ... embody, use, reflect, rest upon, or apply laws
of nature, natural phenomena, or abstract ideas,"' and whether one takes a
macroscopic or microscopic view of a claim may be determinative on the
issue. Alice, 134 S. Ct. at 2354.
Claims 1 and 15 are closely analogous to a claim held patent-eligible
in Rapid Litigation Management Ltd. v. CellzDirect, Inc., 827 F.3d 1042
(Fed. Cir. 2016), which involved producing frozen hepatocytes. Id. at 1046.
Just as the method in Cellzdirect "is not simply an observation or detection
of the ability of hepatocytes to survive multiple freeze-thaw cycles," id. at
1048, the instant claims 1 and 15 are not simply a method of observing but
4
Appeal2017-007169
Application 13/121,195
rather "recite processes to achieve a desired outcome, e.g., methods of
producing things." id. at 1048-9. That is, the instant claims are entirely
physical, not abstract, and we agree with Appellants that "[i]rrespective of
whether these specific steps were previously known, these steps are clearly
directed to the performance of procedures utilizing physical objects on a
support and are not merely directed to an abstract idea or mathematical
formula" (Reply Br. 6).
The claimed "technique, for producing a tangible and useful result,
falls squarely outside those categories of inventions that are 'directed to'
patent-ineligible concepts." Cellzdirect, 827 F.3d at 1050. Therefore, these
claims are not directed to an abstract idea and thus the claims survive Alice
step one and are therefore patent eligible. We note that "[i]f the claims are
not directed to a patent ineligible concept at step one, we need not address
step two of the inquiry." Vanda Pharm. Inc. v. West-Ward Pharm. Int. Ltd.,
887 F.3d 1117, 1134 (Fed. Cir. 2018).
We therefore conclude that Supreme Court and Federal Circuit
precedent supports the conclusion that the claims on appeal are directed to
patent-eligible subject matter.
B. 35 U.S.C. § 103(a) over Van Beuningen, Khan, and Peixoto
The Examiner finds Van Beuningen teaches each of the limitations of
claim 1, including the use of an internal reference but acknowledges that
Van Beuningen "is silent on the explicit use of a reporter nucleic acid which
consists of only a single nucleotide" (Ans. 2-3). The Examiner also finds
Khan and Peixoto teach internal references (id. at 5).
5
Appeal2017-007169
Application 13/121,195
The Examiner finds "oligonucleotide stretches of a single basetype
were well known at the time" and that use of such a single oligonucleotide
stretch in the place of the internal reference of Van Beuningen, Khan, or
Peixoto represents a "simple substitution of one known element for another
to obtain predictable results" (Ans. 4).
The issue with respect to this rejection is: Does a preponderance of
the evidence of record support the Examiner's conclusion that claim 1 would
have been obvious?
Findings of Fact
1. Van Beuningen teaches "providing a microarray comprising a
substrate wherein each binding substance immobilized onto said substrate
comprises a predetermined amount of receptor and a predetermined amount
of an internal reference" (Van Beuningen ,r 11 ).
2. Van Beuningen teaches the "polynucleotides can be
immobilized on the substrate using a wide variety of techniques. For
example ... they may be covalently attached to the substrate" (Van
Beuningen ,r 7 6).
3. Van Beuningen teaches "the use of reporter polynucleotides
and/or analyte nucleic acids that are capable of generating a signal when
appropriately bound, e.g. hybridized, to the array" (Van Beuningen ,r 102).
4. Van Beuningen teaches "differences in signal intensities
between different spots may instead be due to differences in the amounts of
polynucleotide immobilized at the respective spots or amounts of analytes
due to sample preparation" (Van Beuningen ,r 136).
6
Appeal2017-007169
Application 13/121,195
5. Van Beuningen teaches
Because each spot in the arrays of the invention contains an
amount of an internal reference proportional to the amount of
receptor immobilized at the particular spot, the assay signals
obtained from the arrays of the invention can be normalized.
As a consequence, signal intensities from spots within a single
array, within spots, or across multiple arrays, can be directly
compared, without regard to the fidelity of the particular array
synthesis or the sample preparation.
(Van Beuningen ,r 137).
6. Van Beuningen teaches a "normalized signal of a particular
spot is defined by (Ia-Ib)/Ib, where Ia is the intensity of the assay signal of
the spot ( e.g. intensity of the spot after hybridization) and lb is the intensity
of the background signal of the spot ( e.g. the intensity of the spot before
hybridization)" (Van Beuningen ,r 138).
7. Van Beuningen teaches the "composition of the immobilized
polynucleotides, e.g. receptors and internal references, is not critical. The
only requirement is that they be capable of hybridizing to a target nucleic
acid of complementary sequence, e.g. reporters and analytes, if any" (Van
Beuningen ,r 64 ). Van Beuningen teaches an internal reference probe
sequence of "tgcaaagtatcatccctccag" (Van Beuningen ,r 180).
8. Khan teaches "vRNA can also be used for quality control of
microarray printing and PCR product quality, detection of hybridization
anomalies, and simplification of spot finding and segmentation tasks" (Khan
1, abstract).
9. Khan teaches "[ w ]e measured detectability as a function of
signal-to-noise ratio (SNR) and signal-to-background ratio (SBR)" (Khan 8,
col. 1 ).
7
Appeal2017-007169
Application 13/121,195
10. Peixoto teaches the "unlimited availability of an inexpensive
(-US$ 0.30 per hybridization), chemically synthesized reference
oligonucleotide makes its use very convenient in large-scale projects"
(Peixoto 7, col. 1 ).
11. Peixoto teaches "only spots whose background-subtracted
intensities measured in both channels were 2 standard deviations above the
local background ( defined for each sub-array by a set of plant cDNA
negative control probes) were considered in the analysis" (Peixoto 9, col. 1).
Principles of Law
"The combination of familiar elements according to known methods
is likely to be obvious when it does no more than yield predictable results."
KSR Int'! Co. v. Teleflex Inc., 550 U.S. 398,416 (2007).
"[C]laims in an application are to be given their broadest reasonable
interpretation consistent with the specification and that claim language
should be read in light of the specification as it would be interpreted by one
of ordinary skill in the art." In re Sneed, 710 F.2d 1544, 1548 (Fed. Cir.
1983).
Analysis
We begin with claim interpretation because, before a claim is properly
interpreted, its scope cannot be compared to the prior art. We find that two
phrases in claim 1 require express interpretation: (i) "determining a value
indicative for the condition of said nucleic acids via the amount of labeled
oligonucleotide being in complex with the immobilized nucleic acid" and
(ii) "each of the immobilized nucleic acids includes a stretch of nucleotides
of only one base type".
8
Appeal2017-007169
Application 13/121,195
(i) "determining a value"
We first look to the Specification to interpret this phrase. The
Specification defines this term as "the measurement of the degree of
interaction between an immobilized nucleic acid and the complementary
oligonucleotide" (Spec. 18:2-3). The Specification explains the "'degree of
interaction' means a numerical value which is derivable from the
measurement of a physical, e.g. optical ... signal" that compares an
immobilized area to an area in which no nucleic acid was immobilized (see
Spec. 18 :21-26).
Thus, consistent with the Specification and claim 1, the "determining
a value" recitation encompasses an optical signal measurement that
compares signal values between measurements of areas with and without
immobilized nucleic acids (cf Ans. 12).
(ii) "includes a stretch of nucleotides of only one base type"
We interpret this phrase of claim 1 consistent with In re Crish, 393
F.3d 1253, 1257 (Fed. Cir. 2004). Crish found that the "reasonable
interpretation of the claims containing both of the terms 'comprising' and
'consists' is that the term 'consists' limits the 'said portion' language to the
subsequently recited numbered nucleotides, but the earlier term 'comprising'
means that the claim can include that portion plus other nucleotides." Crish,
393 F.3d at 1257.
Consistent with Crish, we interpret the "only one base type" limitation
to require a region in the oligonucleotide that is composed of a polymer
composed of only one base, but the "includes" recitation to permit the
oligonucleotide to contain that portion plus other nucleotides. Dependent
claim 11 supports this interpretation because claim 11 provides a formula
9
Appeal2017-007169
Application 13/121,195
that suggests the oligonucleotide may include stretches of nucleotides of
only one base type in combination with an element "B" that is "a sequence
of more than one basetype." For claim 11 to be properly dependent, claim 1
must encompass oligonucleotides that have regions with both one base type
and with "more than one basetype" as required by the presumably narrower
dependent claim.
Claim 1
We agree with the Examiner that the combination of Van Beuningen,
Khan, and Peixoto renders claim 1 obvious (Ans. 2-5; FF 1-11).
Appellants contend "Van Beuningen fails to teach or suggest a
method wherein a value indicative of the condition of nucleic acids is
determined based on the amount of labeled oligonucleotides being in
complex with the immobilized nucleic acid" (App. Br. 11 ). Appellants
contend the "Van Beuningen method specifically is configured to utilize the
determined level that the reporter binds to the internal reference coupled to
the immobilized polynucleotide to normalize readings of signals from
different arrays without analyzing or determining a value indicative of the
condition of the nucleic acid" (id. 12). Appellants contend "[t]herefore, the
intensity of the assay signal at different spots does not determine the
condition of the nucleic acids whatsoever" (id. 13).
We find these arguments unpersuasive because the "determining a
value" recitation, as interpreted above, encompasses an optical signal
measurement that compares signal values between measurements of areas
with and without immobilized nucleic acids. Van Beuningen teaches that
one concern is differences in signal intensities between different microarray
locations (FF 4), that normalization of the signals can address this concern
10
Appeal2017-007169
Application 13/121,195
(FF 5) and states that the "normalized signal of a particular spot is defined
by (Ia-lb )/lb, where Ia is the intensity of the assay signal of the spot ( e.g.
intensity of the spot after hybridization) and lb is the intensity of the
background signal of the spot ( e.g. the intensity of the spot before
hybridization)" (FF 6).
Thus, Van Beuningen suggests comparing the optical signal of a spot
before and after hybridization, consistent with the teaching in the
Specification that the "value may also refer to the signal strength which is
adjusted to the background signal at one or more areas of the substrate"
(Spec. 18:34--35). Therefore, we note that these teachings of Van
Beuningen fall within the scope of the phrase "determining a value" as
interpreted in light of the Specification.
We further note that the other two prior art references also suggest
comparison of signal to background, where Khan teaches measurement of a
"signal-to-background ratio" (FF 9) and Peixoto teaches "only spots whose
background-subtracted intensities measured in both channels were 2
standard deviations above the local background ( defined for each sub-array
by a set of plant cDNA negative control probes) were considered in the
analysis" (FF 11 ). Thus, the ordinary artisan, interested in addressing the
desire of Van Beuningen that "signal intensities from spots within a single
array, within spots, or across multiple arrays, can be directly compared,
without regard to the fidelity of the particular array synthesis" (FF 5), would
have had reason to determine the signal to background values to ensure the
accuracy of the nucleic acid measurements as suggested by Van Beuningen
(FF 6), Khan (FF 9), and Peixoto (FF 11) (cf Ans. 11-13).
11
Appeal2017-007169
Application 13/121,195
While we agree with Appellants' argument that "the feature of
determining a value indicative for the condition of the nucleic acid must be a
numerical value that specifically concerns the condition of the nucleic acid"
(Reply Br. 8), that argument is not relevant because the normalized signal of
Van Beuningen is a numerical value that specifically addresses the amount
and ability of the nucleic acid to hybridize to a reporter, which are
conditions of the nucleic acid (see FF 4, 6). This is clearly evident in Table
3 of Van Beuningen, which shows a variety of different numerical values for
the normalized oligonucleotides (see Van Beuningen ,r 201 ).
Appellants contend "Van Beuningen fails to teach or suggest at least
the features of an immobilized nucleic acid including a 'stretch of
nucleotides of only one basetype' or the provision of 'a labeled
oligonucleotide complementary to the stretch of nucleotides of only one
basetype"' (App. Br. 13).
We find this argument unpersuasive for several reasons. First, Van
Beuningen teaches that any sequence will function as the internal reference
because the sequence "is not critical" (FF 7). Therefore, we agree with the
Examiner that the ordinary artisan, well aware of oligonucleotides composed
of a single base, 8 would have found "their substitution for the reference
sequences used by Van Beuningen (and/or Khan and/or Peixoto) would have
yielded predictable results" (Ans. 15).
Second, Claim 1, particularly when read in light of Claim 11 as
discussed in the claim interpretation above, requires only that the stretch of
nucleotides of only one basetype be two nucleotides in length or longer
8 We note that Appellants do not dispute that oligonucleotides of a single
base were known to the ordinary artisan in the prior art (see App. Br. 14).
12
Appeal2017-007169
Application 13/121,195
embedded in a longer sequence. Thus, the internal reference sequence
disclosed by Van Beuningen, with an oligonucleotide region of "aaa" and an
oligonucleotide region of "ccc", reasonably satisfies the requirement in
Claim 1 of a "stretch of nucleotides of only one basetype" when read in light
of the claims and Specification (FF 7;cf Ans. 3). Because Claim 1 uses the
term "includes", the sequence may include additional nucleotides within the
overall oligonucleotide as discussed in the claim interpretation above, and
therefore the internal reference sequence oligonucleotide of Van Beuningen
reasonably satisfies the recitations required by Claim 1.
Appellants contend "that the utilization of an immobilized nucleic
acid having a stretch of nucleotides of only one basetype and a labeled
oligonucleotide that is complementary thereto and the advantages provided
thereby would not have been obvious to a person with ordinary skill in the
art" (App. Br. 14).
We find this argument unpersuasive because Appellants provide no
evidence that there is any advantage to the use of a stretch of nucleotides of
only one basetype that would have been unexpected or unobvious to the
ordinary artisan. See In re Pearson, 494 F.2d 1399, 1405 (CCPA 1974)
("Attorney's argument in a brief cannot take the place of evidence."). See
also In re De Blauwe, 736 F.2d 699, 705 (Fed. Cir. 1984) (Arguments and
conclusions unsupported by factual evidence carry no evidentiary weight.)
Claims 2 and 17
Appellants rely upon their arguments regarding claim 1 (see App. Br.
18-19). Because we find that argument unpersuasive, we also find the
repetition of the same argument regarding claims 2 and 17 unpersuasive.
13
Appeal2017-007169
Application 13/121,195
Claims 3 and 4
Appellants rely upon their arguments regarding claim 1 (see App. Br.
19-20). Because we find that argument unpersuasive, we also find the
repetition of the same argument regarding claims 3 and 4 unpersuasive.
Claim 15
Appellants rely upon their arguments regarding claim 1 (see App. Br.
20-23). Because we find that argument unpersuasive, we also find the
repetition of the same argument regarding claim 15 unpersuasive.
Claims 16 and 18
Appellants contend "[ n ]either Van Beuningen, [Khan] nor Peixoto
disclose or suggest providing a labeled test oligonucleotide complementary
to a predefined specific stretch of nucleotides on the nucleic acids that are
outside the stretch of nucleotides of only one basetype" (App. Br. 22).
We find this argument unpersuasive because, as discussed above and
by the Examiner (see Ans. 3), Van Beuningen teaches an internal reference
oligonucleotide with a sequence of "tgcaaagtatcatccctccag" (FF 7). This
sequence has two regions that satisfy the "stretch of nucleotides of only one
basetype," the "aaa" and "ccc" regions, and also contain additional
sequences that are "outside the stretch of nucleotides of only one basetype"
as required by claims 16 and 18. Moreover, as noted by the Examiner, the
specific sequence selection represents an obvious substitution and
Appellants provide no evidence demonstrating any secondary consideration
or other criticality with regard to the particular sequences used for the
internal reference oligonucleotide.
14
Appeal2017-007169
Application 13/121,195
Conclusion of Law
A preponderance of the evidence of record supports the Examiner's
conclusion that claim 1 would have been obvious.
C. 35 U.S.C. § 103(a) over Van Beuningen, Khan, Peixoto, and
Penchovsky
Appellants do not separately argue this obviousness rejection, instead relying
upon their arguments to overcome the combination of Van Beuningen, Khan, and
Peixoto. The Examiner provides sound fact-based reasoning for combining
Penchovsky with Van Beuningen, Khan, and Peixoto (see Ans. 5-7). Having
affirmed the obviousness rejection of claim 1 over Van Beuningen, Khan, and Peixoto
for the reasons given above, we also determine that the further combinations with
Penchovsky renders the rejected claims obvious for the reasons given by the
Examiner.
SUMMARY
In summary, we reverse the rejection of claims 1, 5-16, and 18 under
35 U.S.C. § 101 as directed to an abstract idea.
We affirm the rejection of claims 1-7 and 9-18 under 35 U.S.C.
§ 103(a) as obvious over Van Beuningen, Khan, and Peixoto.
We affirm the rejection of claims 1-18 under 35 U.S.C. § 103(a) as
obvious over Van Beuningen, Khan, Peixoto, and Penchovsky.
No time period for taking any subsequent action in connection with
this appeal may be extended under 37 C.F.R. § 1.136(a)(l )(iv).
AFFIRMED
15