Ex Parte Pierik et alDownload PDFPatent Trial and Appeal BoardAug 28, 201813121195 (P.T.A.B. Aug. 28, 2018) Copy Citation UNITED STA TES p A TENT AND TRADEMARK OFFICE APPLICATION NO. FILING DATE FIRST NAMED INVENTOR 13/121, 195 03/28/2011 Anke Pierik 24737 7590 08/30/2018 PHILIPS INTELLECTUAL PROPERTY & STANDARDS 465 Columbus A venue Suite 340 Valhalla, NY 10595 UNITED STATES DEPARTMENT OF COMMERCE United States Patent and Trademark Office Address: COMMISSIONER FOR PATENTS P.O. Box 1450 Alexandria, Virginia 22313-1450 www .uspto.gov ATTORNEY DOCKET NO. CONFIRMATION NO. 2008P01150WOUS 6845 EXAMINER FLINDERS, JEREMY C ART UNIT PAPER NUMBER 1639 NOTIFICATION DATE DELIVERY MODE 08/30/2018 ELECTRONIC Please find below and/or attached an Office communication concerning this application or proceeding. The time period for reply, if any, is set in the attached communication. Notice of the Office communication was sent electronically on above-indicated "Notification Date" to the following e-mail address(es): patti. demichele@Philips.com marianne.fox@philips.com katelyn.mulroy@philips.com PTOL-90A (Rev. 04/07) UNITED STATES PATENT AND TRADEMARK OFFICE BEFORE THE PATENT TRIAL AND APPEAL BOARD Ex parte ANKE PIERIK and HENDRIK ROELOF ST APER T Appeal2017-007169 Application 13/121,195 Technology Center 1600 Before JEFFREYN. FREDMAN, MICHAEL J. FITZPATRICK, and JOHN E. SCHNEIDER, Administrative Patent Judges. FREDMAN, Administrative Patent Judge. DECISION ON APPEAL This is an appeal 1,2 under 35 U.S.C. § 134 involving claims to a method for testing nucleic acids on a support. The Examiner rejected the claims as obvious. We have jurisdiction under 35 U.S.C. § 6(b). We affirm. Statement of the Case Background "Biochips or biological microarrays ... consist of an arrayed series of a large number of microscopic spots of nucleic acid molecules, each 1 Appellants identify the Real Party in Interest as KONINKLIJKE PHILIPS N.V. (see App. Br. 4). 2 We have considered and herein refer to the Specification of Mar. 28, 2011 ("Spec."); Final Office Action of July 7, 2016 ("Final Action"); Appeal Brief of Dec. 2, 2016 ("App. Br."); Examiner's Answer of Feb. 7, 2017 ("Answer"); and Reply Brief of Apr. 5, 2017 ("Reply Br."). Appeal2017-007169 Application 13/121,195 containing small amounts of a specific nucleic acid sequence ... that are used as capture probes to hybridize a cDNA or cRNA sample" (Spec. 1: 17- 22). "Capture probe-target hybridization is typically detected and quantified by fluorescence-based detection of fluorophore-labeled targets to determine relative abundance of nucleic acid sequences in the target" (id. 1 :23-25). "During the manufacturing process of microarrays it is necessary to know whether each spot on the substrate is present and can still hybridize" (id. 3:5---6). "The present invention addresses this need and provides means and methods which allow the immobilization and subsequent testing and quality-controlling of nucleic acids deposited on a support" (id. 3 :20-22). The Claims Claims 1-18 are on appeal. Claim 1 is representative and reads as follows: 1. A method for testing nucleic acids on a support, comprising the steps of: (a) immobilizing one or more nucleic acids on a solid support via crosslinking by heat or light or via chemical immobilization, wherein each of the immobilized nucleic acids includes a stretch of nucleotides of only one basetype; (b) providing a labeled oligonucleotide complementary to the stretch of nucleotides of only one basetype, wherein said labeled oligonucleotide is capable of forming a complex with each of the immobilized nucleic acids at the stretch of nucleotides of only one basetype; and ( c) determining a value indicative for the condition of said nucleic acids via the amount of labeled oligonucleotide being in complex with the immobilized nucleic acid. 2 Appeal2017-007169 Application 13/121,195 The Re} ections3 A. The Examiner has rejected claims 1, 5-16, and 18 under 35 U.S.C. § 101 as directed to an abstract idea (Ans. 7-10). B. The Examiner has rejected claims 1-7 and 9-18 under 35 U.S.C. § I03(a) as obvious over Van Beuningen, 4 Khan, 5 and Peixoto6 (Ans. 2-5). C. The Examiner has rejected claims 1-18 under 35 U.S.C. § I03(a) as obvious over Van Beuningen, Khan, Peixoto, and Penchovsky7 (Ans. 5-7). A. 35 U.S.C. § 1 OJ The Examiner finds all of the claims on appeal unpatentable under 35 U.S.C. § 101 as being directed to patent-ineligible subject matter, specifically the abstract idea of "'determining a value indicative for the condition of ... nucleic acids' based on the observed presence or amount of labeled oligonucleotide being in complex with said nucleic acids" (Ans. 7). To determine whether a claim is invalid under§ 101, we employ the two-step Alice framework. In step one, we ask whether the claims are 3 The Examiner entered a new ground of rejection under 35 U.S.C. § 101 in the Examiner's Answer authorized by the TC Director (see Ans. 7-10, 16) that was addressed by Appellants in the Reply Brief (see Reply Br. 5---6). 4 Van Beuningen, US 2005/0153290 Al, published July 14, 2005. 5 Khan et al., A universal reference sample derived from clone vector for improved detection of differential gene expression, 7 BMC GENOMICS 109, pages numbered 1-10 (2006). 6 Peixoto et al., Evaluation of reference-based two-color methods for measurement of gene expression ratios using spotted cDNA microarrays, 7 BMC GENOMICS 35, pages numbered 1-12 (2006). 7 Penchovsky et al., End-specific covalent photo-dependent immobilization of synthetic DNA to paramagnetic beads, 28 NUCLEIC ACIDS RES. E98, pages numbered 1---6 (2000). 3 Appeal2017-007169 Application 13/121,195 directed to a patent ineligible concept, such as an abstract idea or law of nature. Alice Corp. Pty. Ltd. v. CLS Bank Int'!, 134 S.Ct. 2347, 2355 (2014); Mayo Collaborative Services v. Prometheus Laboratories, Inc., 566 U.S. 66, 75-77 (2012); Ariosa Diagnostics, Inc. v. Sequenom, Inc., 788 F.3d 1371, 1375 (Fed. Cir. 2015). While method claims are generally eligible subject matter, claims that are directed only to abstract ideas and/or natural phenomena are directed to a patent ineligible concept. Ariosa, 788 F .3d at 1376. Alice Step One Claims 1 and 15 of the instant application are directed to methods of analyzing or testing how much nucleic acid is located at a particular location on a support by using an internal reference oligonucleotide of a "one basetype" where hybridization of a labeled complementary oligonucleotide will allow determination of the amount and condition of the immobilized oligonucleotides. Taking up the first step of the patent-eligibility analysis, we note, "[a]t some level, 'all inventions ... embody, use, reflect, rest upon, or apply laws of nature, natural phenomena, or abstract ideas,"' and whether one takes a macroscopic or microscopic view of a claim may be determinative on the issue. Alice, 134 S. Ct. at 2354. Claims 1 and 15 are closely analogous to a claim held patent-eligible in Rapid Litigation Management Ltd. v. CellzDirect, Inc., 827 F.3d 1042 (Fed. Cir. 2016), which involved producing frozen hepatocytes. Id. at 1046. Just as the method in Cellzdirect "is not simply an observation or detection of the ability of hepatocytes to survive multiple freeze-thaw cycles," id. at 1048, the instant claims 1 and 15 are not simply a method of observing but 4 Appeal2017-007169 Application 13/121,195 rather "recite processes to achieve a desired outcome, e.g., methods of producing things." id. at 1048-9. That is, the instant claims are entirely physical, not abstract, and we agree with Appellants that "[i]rrespective of whether these specific steps were previously known, these steps are clearly directed to the performance of procedures utilizing physical objects on a support and are not merely directed to an abstract idea or mathematical formula" (Reply Br. 6). The claimed "technique, for producing a tangible and useful result, falls squarely outside those categories of inventions that are 'directed to' patent-ineligible concepts." Cellzdirect, 827 F.3d at 1050. Therefore, these claims are not directed to an abstract idea and thus the claims survive Alice step one and are therefore patent eligible. We note that "[i]f the claims are not directed to a patent ineligible concept at step one, we need not address step two of the inquiry." Vanda Pharm. Inc. v. West-Ward Pharm. Int. Ltd., 887 F.3d 1117, 1134 (Fed. Cir. 2018). We therefore conclude that Supreme Court and Federal Circuit precedent supports the conclusion that the claims on appeal are directed to patent-eligible subject matter. B. 35 U.S.C. § 103(a) over Van Beuningen, Khan, and Peixoto The Examiner finds Van Beuningen teaches each of the limitations of claim 1, including the use of an internal reference but acknowledges that Van Beuningen "is silent on the explicit use of a reporter nucleic acid which consists of only a single nucleotide" (Ans. 2-3). The Examiner also finds Khan and Peixoto teach internal references (id. at 5). 5 Appeal2017-007169 Application 13/121,195 The Examiner finds "oligonucleotide stretches of a single basetype were well known at the time" and that use of such a single oligonucleotide stretch in the place of the internal reference of Van Beuningen, Khan, or Peixoto represents a "simple substitution of one known element for another to obtain predictable results" (Ans. 4). The issue with respect to this rejection is: Does a preponderance of the evidence of record support the Examiner's conclusion that claim 1 would have been obvious? Findings of Fact 1. Van Beuningen teaches "providing a microarray comprising a substrate wherein each binding substance immobilized onto said substrate comprises a predetermined amount of receptor and a predetermined amount of an internal reference" (Van Beuningen ,r 11 ). 2. Van Beuningen teaches the "polynucleotides can be immobilized on the substrate using a wide variety of techniques. For example ... they may be covalently attached to the substrate" (Van Beuningen ,r 7 6). 3. Van Beuningen teaches "the use of reporter polynucleotides and/or analyte nucleic acids that are capable of generating a signal when appropriately bound, e.g. hybridized, to the array" (Van Beuningen ,r 102). 4. Van Beuningen teaches "differences in signal intensities between different spots may instead be due to differences in the amounts of polynucleotide immobilized at the respective spots or amounts of analytes due to sample preparation" (Van Beuningen ,r 136). 6 Appeal2017-007169 Application 13/121,195 5. Van Beuningen teaches Because each spot in the arrays of the invention contains an amount of an internal reference proportional to the amount of receptor immobilized at the particular spot, the assay signals obtained from the arrays of the invention can be normalized. As a consequence, signal intensities from spots within a single array, within spots, or across multiple arrays, can be directly compared, without regard to the fidelity of the particular array synthesis or the sample preparation. (Van Beuningen ,r 137). 6. Van Beuningen teaches a "normalized signal of a particular spot is defined by (Ia-Ib)/Ib, where Ia is the intensity of the assay signal of the spot ( e.g. intensity of the spot after hybridization) and lb is the intensity of the background signal of the spot ( e.g. the intensity of the spot before hybridization)" (Van Beuningen ,r 138). 7. Van Beuningen teaches the "composition of the immobilized polynucleotides, e.g. receptors and internal references, is not critical. The only requirement is that they be capable of hybridizing to a target nucleic acid of complementary sequence, e.g. reporters and analytes, if any" (Van Beuningen ,r 64 ). Van Beuningen teaches an internal reference probe sequence of "tgcaaagtatcatccctccag" (Van Beuningen ,r 180). 8. Khan teaches "vRNA can also be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks" (Khan 1, abstract). 9. Khan teaches "[ w ]e measured detectability as a function of signal-to-noise ratio (SNR) and signal-to-background ratio (SBR)" (Khan 8, col. 1 ). 7 Appeal2017-007169 Application 13/121,195 10. Peixoto teaches the "unlimited availability of an inexpensive (-US$ 0.30 per hybridization), chemically synthesized reference oligonucleotide makes its use very convenient in large-scale projects" (Peixoto 7, col. 1 ). 11. Peixoto teaches "only spots whose background-subtracted intensities measured in both channels were 2 standard deviations above the local background ( defined for each sub-array by a set of plant cDNA negative control probes) were considered in the analysis" (Peixoto 9, col. 1). Principles of Law "The combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results." KSR Int'! Co. v. Teleflex Inc., 550 U.S. 398,416 (2007). "[C]laims in an application are to be given their broadest reasonable interpretation consistent with the specification and that claim language should be read in light of the specification as it would be interpreted by one of ordinary skill in the art." In re Sneed, 710 F.2d 1544, 1548 (Fed. Cir. 1983). Analysis We begin with claim interpretation because, before a claim is properly interpreted, its scope cannot be compared to the prior art. We find that two phrases in claim 1 require express interpretation: (i) "determining a value indicative for the condition of said nucleic acids via the amount of labeled oligonucleotide being in complex with the immobilized nucleic acid" and (ii) "each of the immobilized nucleic acids includes a stretch of nucleotides of only one base type". 8 Appeal2017-007169 Application 13/121,195 (i) "determining a value" We first look to the Specification to interpret this phrase. The Specification defines this term as "the measurement of the degree of interaction between an immobilized nucleic acid and the complementary oligonucleotide" (Spec. 18:2-3). The Specification explains the "'degree of interaction' means a numerical value which is derivable from the measurement of a physical, e.g. optical ... signal" that compares an immobilized area to an area in which no nucleic acid was immobilized (see Spec. 18 :21-26). Thus, consistent with the Specification and claim 1, the "determining a value" recitation encompasses an optical signal measurement that compares signal values between measurements of areas with and without immobilized nucleic acids (cf Ans. 12). (ii) "includes a stretch of nucleotides of only one base type" We interpret this phrase of claim 1 consistent with In re Crish, 393 F.3d 1253, 1257 (Fed. Cir. 2004). Crish found that the "reasonable interpretation of the claims containing both of the terms 'comprising' and 'consists' is that the term 'consists' limits the 'said portion' language to the subsequently recited numbered nucleotides, but the earlier term 'comprising' means that the claim can include that portion plus other nucleotides." Crish, 393 F.3d at 1257. Consistent with Crish, we interpret the "only one base type" limitation to require a region in the oligonucleotide that is composed of a polymer composed of only one base, but the "includes" recitation to permit the oligonucleotide to contain that portion plus other nucleotides. Dependent claim 11 supports this interpretation because claim 11 provides a formula 9 Appeal2017-007169 Application 13/121,195 that suggests the oligonucleotide may include stretches of nucleotides of only one base type in combination with an element "B" that is "a sequence of more than one basetype." For claim 11 to be properly dependent, claim 1 must encompass oligonucleotides that have regions with both one base type and with "more than one basetype" as required by the presumably narrower dependent claim. Claim 1 We agree with the Examiner that the combination of Van Beuningen, Khan, and Peixoto renders claim 1 obvious (Ans. 2-5; FF 1-11). Appellants contend "Van Beuningen fails to teach or suggest a method wherein a value indicative of the condition of nucleic acids is determined based on the amount of labeled oligonucleotides being in complex with the immobilized nucleic acid" (App. Br. 11 ). Appellants contend the "Van Beuningen method specifically is configured to utilize the determined level that the reporter binds to the internal reference coupled to the immobilized polynucleotide to normalize readings of signals from different arrays without analyzing or determining a value indicative of the condition of the nucleic acid" (id. 12). Appellants contend "[t]herefore, the intensity of the assay signal at different spots does not determine the condition of the nucleic acids whatsoever" (id. 13). We find these arguments unpersuasive because the "determining a value" recitation, as interpreted above, encompasses an optical signal measurement that compares signal values between measurements of areas with and without immobilized nucleic acids. Van Beuningen teaches that one concern is differences in signal intensities between different microarray locations (FF 4), that normalization of the signals can address this concern 10 Appeal2017-007169 Application 13/121,195 (FF 5) and states that the "normalized signal of a particular spot is defined by (Ia-lb )/lb, where Ia is the intensity of the assay signal of the spot ( e.g. intensity of the spot after hybridization) and lb is the intensity of the background signal of the spot ( e.g. the intensity of the spot before hybridization)" (FF 6). Thus, Van Beuningen suggests comparing the optical signal of a spot before and after hybridization, consistent with the teaching in the Specification that the "value may also refer to the signal strength which is adjusted to the background signal at one or more areas of the substrate" (Spec. 18:34--35). Therefore, we note that these teachings of Van Beuningen fall within the scope of the phrase "determining a value" as interpreted in light of the Specification. We further note that the other two prior art references also suggest comparison of signal to background, where Khan teaches measurement of a "signal-to-background ratio" (FF 9) and Peixoto teaches "only spots whose background-subtracted intensities measured in both channels were 2 standard deviations above the local background ( defined for each sub-array by a set of plant cDNA negative control probes) were considered in the analysis" (FF 11 ). Thus, the ordinary artisan, interested in addressing the desire of Van Beuningen that "signal intensities from spots within a single array, within spots, or across multiple arrays, can be directly compared, without regard to the fidelity of the particular array synthesis" (FF 5), would have had reason to determine the signal to background values to ensure the accuracy of the nucleic acid measurements as suggested by Van Beuningen (FF 6), Khan (FF 9), and Peixoto (FF 11) (cf Ans. 11-13). 11 Appeal2017-007169 Application 13/121,195 While we agree with Appellants' argument that "the feature of determining a value indicative for the condition of the nucleic acid must be a numerical value that specifically concerns the condition of the nucleic acid" (Reply Br. 8), that argument is not relevant because the normalized signal of Van Beuningen is a numerical value that specifically addresses the amount and ability of the nucleic acid to hybridize to a reporter, which are conditions of the nucleic acid (see FF 4, 6). This is clearly evident in Table 3 of Van Beuningen, which shows a variety of different numerical values for the normalized oligonucleotides (see Van Beuningen ,r 201 ). Appellants contend "Van Beuningen fails to teach or suggest at least the features of an immobilized nucleic acid including a 'stretch of nucleotides of only one basetype' or the provision of 'a labeled oligonucleotide complementary to the stretch of nucleotides of only one basetype"' (App. Br. 13). We find this argument unpersuasive for several reasons. First, Van Beuningen teaches that any sequence will function as the internal reference because the sequence "is not critical" (FF 7). Therefore, we agree with the Examiner that the ordinary artisan, well aware of oligonucleotides composed of a single base, 8 would have found "their substitution for the reference sequences used by Van Beuningen (and/or Khan and/or Peixoto) would have yielded predictable results" (Ans. 15). Second, Claim 1, particularly when read in light of Claim 11 as discussed in the claim interpretation above, requires only that the stretch of nucleotides of only one basetype be two nucleotides in length or longer 8 We note that Appellants do not dispute that oligonucleotides of a single base were known to the ordinary artisan in the prior art (see App. Br. 14). 12 Appeal2017-007169 Application 13/121,195 embedded in a longer sequence. Thus, the internal reference sequence disclosed by Van Beuningen, with an oligonucleotide region of "aaa" and an oligonucleotide region of "ccc", reasonably satisfies the requirement in Claim 1 of a "stretch of nucleotides of only one basetype" when read in light of the claims and Specification (FF 7;cf Ans. 3). Because Claim 1 uses the term "includes", the sequence may include additional nucleotides within the overall oligonucleotide as discussed in the claim interpretation above, and therefore the internal reference sequence oligonucleotide of Van Beuningen reasonably satisfies the recitations required by Claim 1. Appellants contend "that the utilization of an immobilized nucleic acid having a stretch of nucleotides of only one basetype and a labeled oligonucleotide that is complementary thereto and the advantages provided thereby would not have been obvious to a person with ordinary skill in the art" (App. Br. 14). We find this argument unpersuasive because Appellants provide no evidence that there is any advantage to the use of a stretch of nucleotides of only one basetype that would have been unexpected or unobvious to the ordinary artisan. See In re Pearson, 494 F.2d 1399, 1405 (CCPA 1974) ("Attorney's argument in a brief cannot take the place of evidence."). See also In re De Blauwe, 736 F.2d 699, 705 (Fed. Cir. 1984) (Arguments and conclusions unsupported by factual evidence carry no evidentiary weight.) Claims 2 and 17 Appellants rely upon their arguments regarding claim 1 (see App. Br. 18-19). Because we find that argument unpersuasive, we also find the repetition of the same argument regarding claims 2 and 17 unpersuasive. 13 Appeal2017-007169 Application 13/121,195 Claims 3 and 4 Appellants rely upon their arguments regarding claim 1 (see App. Br. 19-20). Because we find that argument unpersuasive, we also find the repetition of the same argument regarding claims 3 and 4 unpersuasive. Claim 15 Appellants rely upon their arguments regarding claim 1 (see App. Br. 20-23). Because we find that argument unpersuasive, we also find the repetition of the same argument regarding claim 15 unpersuasive. Claims 16 and 18 Appellants contend "[ n ]either Van Beuningen, [Khan] nor Peixoto disclose or suggest providing a labeled test oligonucleotide complementary to a predefined specific stretch of nucleotides on the nucleic acids that are outside the stretch of nucleotides of only one basetype" (App. Br. 22). We find this argument unpersuasive because, as discussed above and by the Examiner (see Ans. 3), Van Beuningen teaches an internal reference oligonucleotide with a sequence of "tgcaaagtatcatccctccag" (FF 7). This sequence has two regions that satisfy the "stretch of nucleotides of only one basetype," the "aaa" and "ccc" regions, and also contain additional sequences that are "outside the stretch of nucleotides of only one basetype" as required by claims 16 and 18. Moreover, as noted by the Examiner, the specific sequence selection represents an obvious substitution and Appellants provide no evidence demonstrating any secondary consideration or other criticality with regard to the particular sequences used for the internal reference oligonucleotide. 14 Appeal2017-007169 Application 13/121,195 Conclusion of Law A preponderance of the evidence of record supports the Examiner's conclusion that claim 1 would have been obvious. C. 35 U.S.C. § 103(a) over Van Beuningen, Khan, Peixoto, and Penchovsky Appellants do not separately argue this obviousness rejection, instead relying upon their arguments to overcome the combination of Van Beuningen, Khan, and Peixoto. The Examiner provides sound fact-based reasoning for combining Penchovsky with Van Beuningen, Khan, and Peixoto (see Ans. 5-7). Having affirmed the obviousness rejection of claim 1 over Van Beuningen, Khan, and Peixoto for the reasons given above, we also determine that the further combinations with Penchovsky renders the rejected claims obvious for the reasons given by the Examiner. SUMMARY In summary, we reverse the rejection of claims 1, 5-16, and 18 under 35 U.S.C. § 101 as directed to an abstract idea. We affirm the rejection of claims 1-7 and 9-18 under 35 U.S.C. § 103(a) as obvious over Van Beuningen, Khan, and Peixoto. We affirm the rejection of claims 1-18 under 35 U.S.C. § 103(a) as obvious over Van Beuningen, Khan, Peixoto, and Penchovsky. No time period for taking any subsequent action in connection with this appeal may be extended under 37 C.F.R. § 1.136(a)(l )(iv). AFFIRMED 15 Copy with citationCopy as parenthetical citation