14421772 - (D) (P.T.A.B. Apr. 9, 2019)

Ex Parte Lescar et al

Patent Trials and Appeals BoardApr 9, 2019

14421772 - (D) (P.T.A.B. Apr. 9, 2019)

UNITED STA TES p A TENT AND TRADEMARK OFFICE APPLICATION NO. FILING DATE FIRST NAMED INVENTOR 14/421,772 02/13/2015 Julien Lescar 500 7590 04/11/2019 SEED INTELLECTUAL PROPERTY LAW GROUP LLP 701 FIFTH A VE SUITE 5400 SEATTLE, WA 98104 UNITED STATES DEPARTMENT OF COMMERCE United States Patent and Trademark Office Address: COMMISSIONER FOR PATENTS P.O. Box 1450 Alexandria, Virginia 22313-1450 www .uspto.gov ATTORNEY DOCKET NO. CONFIRMATION NO. 690148.476USPC 9440 EXAMINER HADDAD, MAHER M ART UNIT PAPER NUMBER 1644 NOTIFICATION DATE DELIVERY MODE 04/11/2019 ELECTRONIC Please find below and/or attached an Office communication concerning this application or proceeding. The time period for reply, if any, is set in the attached communication. Notice of the Office communication was sent electronically on above-indicated "Notification Date" to the following e-mail address(es): USPTOeAction@SeedIP.com pairlinkdktg@seedip.com PTOL-90A (Rev. 04/07) UNITED STATES PATENT AND TRADEMARK OFFICE BEFORE THE PATENT TRIAL AND APPEAL BOARD Ex parte JULIEN LESCAR, YEE HWA WONG, WEI MIN EDMOND CHUA, NGUAN SOON ANDREW TAN, HAN CHUNG KELVIN CHONG, MING JAE TAN, and ROYSTON-LUKE HUANG Appeal2018-007790 Application 14/421, 772 Technology Center 1600 Before ULRIKE W. JENKS, TIMOTHY G. MAJORS, and MICHAEL A. VALEK, Administrative Patent Judges. VALEK, Administrative Patent Judge. DECISION ON APPEAL Appellants 1 submit this appeal under 35 U.S.C. Â§ 134(a) involving claims to an antibody that binds C terminal region of angiopoietin like 4 protein. The Examiner rejected the claims as anticipated. We have jurisdiction under 35 U.S.C. Â§ 6(b ). 1 Appellants identify the real party in interest as Nanyang Technological University. App. Br. 2. Herein we refer to the Declaration Under 37 CPR 1.132 filed Sept. 11, 2017 ("First Deel."), Declaration Under 37 CPR 1.132 filed Dec. 28, 2017 ("Second Deel."), Final Office Action mailed September 25, 2017 ("Final Act."), Appeal Brief filed April 24, 2018 ("App. Br."), Examiner's Answer mailed May 21, 2018 ("Ans."), and Reply Brief filed July 23, 2018 ("Reply"). Appeal2018-007790 Application 14/421,772 We AFFIRM. We further enter a New Ground of Rejection. STATEMENT OF THE CASE Claims 1, 2, 15-18, 24 and 25 are on appeal, and can be found in the Claims Appendix of the Appeal Brief. Claim 1 is the only independent claim and is representative of the claims on appeal. Claim 1 reads as follows: 1. An antibody that binds C terminal region of angiopoietin like 4 protein ( cANGPTL4) wherein said antibody comprises a heavy chain and a light chain, the heavy chain comprising a VH CDRl, a VH CDR2, and a VH CDR3, and the light chain comprising a VL CDRl, a VL CDR2, and a VL CDR3, wherein: said VL CDRl comprises, consists essentially of or consists of the amino acid sequence of SEQ ID N0:3; said VL CDR2 comprises, consists essentially of or consists of the amino acid sequence of SEQ ID N0:4; said VL CDR3 comprises, consists essentially of or consists of the amino acid sequence of SEQ ID N0:5; said VH CDRl comprises, consists essentially of or consists of the amino acid sequence of SEQ ID N0:6; said VH CDR2 comprises, consists essentially of or consists of the amino acid sequence of SEQ ID N0:7; and said VH CDR3 comprises, consists essentially of or consists of the amino acid sequence of SEQ ID N0:8. App. Br. 13. Appellants do not argue claims 2, 15-18, 24 and 25 separately so those claims stand or fall with claim 1. 37 C.F.R. Â§ 41.37 (c)(l)(iv). Appellants filed their appeal brief seeking review of the following grounds of rejection made by Examiner: I. Claims 1, 2, 15-18, 24, and 25 under 35 U.S.C. Â§ I02(a)(l) as anticipated by Tan ("the Tan Rejection")2 2 Nguan Soon Tan et al., WO 2011/0465515 Al published April 21, 2011 ("Tan"). 2 Appeal2018-007790 Application 14/421,772 II. Claims 1, 2, 24, and 25 under 35 U.S.C. Â§ 102(a)(l) as anticipated by Zhu ("the Zhu Rejection") 3 App. Br. 2-3. 4 Examiner subsequently withdrew the Tan Rejection in the Answer. 5 Ans. 4. The issue is: Does the preponderance of evidence of record support Examiner's conclusion that Zhu anticipates claims 1, 2, 24, and 25? Findings of Fact FF 1. Zhu teaches an antibody that binds C terminal region of angiopoietin like 4 protein (cANGPTL4) called "mAb 11F6C4." Zhu 405, col. 2. Zhu teaches that "mAb 11F6C4 was identified and produced for our immunotherapy experiment based on its superior kon, koff, and KD values, as determined by surface plasmon resonance (SPR)." Id. (citing Fig. S2E and Supplemental Experimental Procedures). The Supplemental Experimental Procedures, 6 published in conjunction with Zhu describe the procedures the authors followed to generate and screen for anti-cANGPTL4 antibodies, including mAB 11F6C4, based on certain binding parameters. See Supp. Info. 14. 3 Pengcheng Zhu et al., Angiopoietin-like 4 Protein Elevates the Prosurvival Intercellular 02-:H202 Ratio and Confers Anoikis Resistance to Tumors, Cancer Cell, Vol. 19, 401--415 (2011) ("Zhu"). 4 Appellants identify claim 13 as being at issue on appeal (see App Br. 4), but that claim was withdrawn and is not before us now. Amendment at 2; see App. Br. 2. 5 Pengcheng Zhu et al., Supplemental Information Angiopoietin-like 4 Protein Elevates the Prosurvival Intercellular 02-:H202 Ratio and Confers Anoikis Resistance to Tumors, Cancer Cell, Vol. 19 (2011 ), available at https://ars.els-cdn.com/content/image/1-s2.0-S 1535610811000304- mmcl .pdf ("Supp. Info."). 3 Appeal2018-007790 Application 14/421,772 FF2. Zhu reports data for various experiments conducted using mAb 11F6C4. See, e.g., Zhu Fig. 2, 3, 7. Zhu teaches that inhibition of ANGPTL4 with mAb 11F6C4 resulted in "attenuated tumor growth" and "reduced cell proliferation and enhanced cell apoptosis." Id. 405, col. 2 ( citing Fig 2E-2I). FF3. Appellants are co-authors of the Zhu reference as well as co-inventors on the Tan PCT application. First Deel. ,r,r 1-2; Second Deel. ,r,r 1-2. Appellants testify that the mAb 11F6C4 antibody described in Zhu and Tan is "the same antibody as currently claimed by us." Id. at ,r 7. FF4. Tan also teaches antibodies that bind cANGPTL4, including "mAb 11F6C4." Tan ,r,r 13, 16, 96, 97, 120. Tan discloses experiments involving mAb 11F6C4, along with data identifying various properties of mAb 11F6C4. Id. at Figs 2, 4, 6, and 11. FF5. Tan teaches immunoglobulins ( or antibodies) that are IgG 1 kappa immunoglobulin. Tan ,r 26. Tan teaches antibodies that comprise a human IgG 1 constant region within a heavy chain and a human constant region within a light chain. Id. ,r 27. Tan teaches that these antibodies may comprise both human and murine framework regions within the variable domains of the light and heavy chains. Id. ,r,r 28-29. 7 Analysis Appellants contend that the disclosure in Zhu does not enable one of skill in the art to practice the claimed subject matter because Zhu does not disclose the sequence of the mAb 11F6C4 antibody. App. Br. 9. According to Appellants, the "process by which monoclonal antibodies are produced is 7 FF4 and FF5 relate to the new ground of rejection entered below. 4 Appeal2018-007790 Application 14/421,772 highly variable" and the process taught in Zhu will produce antibodies that "differ in sequence and specificity ... such that it is virtually a statistical impossibility that one of ordinary skill in the art, following the process exactly as outlined in Tan and/or Zhu, would spontaneously generate the same hybridoma/monoclonal antibody as that produced by the Tan/Zhu" authors. Id. at 10-11. Appellants further argue that their particular antibody mAb 11F6C4 "was kept under confidence in their laboratory and was never made available to any outside investigator prior to filing the present Application." Id. at 11 (citing First and Second Deel.). Thus, urge Appellants, Zhu does not allow one of skill in the art to ascertain the specific sequences recited in Appellants' claims. Id. Examiner finds that "[m]aking the mAb 11F6C4 antibody is not an issue" because "Appellant is claiming the same product" taught in Zhu and the "disclosure of the SEQ ID NOs [in Appellants' application] is mainly further characterization of otherwise old products." Ans. 7. Examiner determines that the claimed "sequences for the CDRs [and other structural properties in Appellants' claims] are intrinsic properties of the mAb 11F6C4 antibody." Final Act. 3. Relying on In re Crish, 393 F.3d 1253 (Fed. Cir. 2004), Examiner determines that Appellants' prior publication of mAb 11F6C4 and a functional description of such in various assays, anticipates the Appellants' present claims to that antibody. Examiner further notes the terms and conditions for publication of Zhu required that "authors be willing to distribute any materials ... used in the published experiments" including "antibodies" should they be requested by other researchers. Final Act. 4. We are not persuaded by Appellants' arguments and agree with Examiner's statement of the rejection and responses to Appellants' 5 Appeal2018-007790 Application 14/421,772 arguments in both the Answer and Final Action, which we adopt and incorporate by reference. In addition, we enter as a new ground of rejection the previously-withdrawn Tan Rejection. We provide the following additional comments to Appellants' arguments. The facts of this case closely follow those in Crish. The claims in Crish were directed to oligonucleotides consisting of defined portions of the nucleotide sequence in SEQ ID NO: 1, which the specification described as the promotor sequence of the hINV gene. 393 F.3d at 1255-57. The Board affirmed the Examiner's rejection of those claims as anticipated by two of the applicants' prior publications. Id. at 1254--55. Those publications described experiments characterizing different aspects of hINV, but they did not disclose the sequence of the promoter region. Id. The Federal Circuit affirmed the Board because "just as the discovery of properties of a known material does not make it novel, the identification and characterization of [the sequence defining the structure] a prior art material does not make it novel." Id. at 1258. It rejected applicants' argument "that a reference is not anticipatory when the use of the same starting materials can yield two similar, yet different compositions" because each of the references there "actually disclose[d] a material that contains the promoter region of hINV." Id.at 1259. Appellants do not address Crish in their briefing and the arguments they do advance fail to distinguish it from the present case. Like the references in Crish, Appellants' prior art publication in Zhu discloses a material containing the same sequence recited in the claims. Indeed, Appellants concede that the mAb 11F6C4 antibody described in Zhu is the same antibody described in the Specification and therefore necessarily 6 Appeal2018-007790 Application 14/421,772 contains the amino acid sequences recited in the claims. FF3; see also Spec. ,r,r 20-22 (identifying SEQ IDs as corresponding to mAb 11F6C4). Thus, it is undisputed that Zhu discloses an antibody that contains the amino acid sequences recited in Appellants' claims. That disclosure is anticipatory, even if it was not until the present application that Appellants characterized mAb 11F6C4 by its amino acid sequence. In addition, the premise for Appellants' argument that one of skill could not reproduce mAb 11F6C4 from the disclosure in Zhu is flawed because Appellants' claims are not limited to mAb 11F6C4. The amino acid sequence mAb 11F6C4's heavy and light chains are listed in SEQ ID N0:1 and 2 respectively. Spec. ,r 22. Claim 1, however, only requires that sequence for certain complementary determining regions (CDRs) defined in SEQ ID N0:3-8. Moreover, for each of those CDRs, claim 1 states that their sequence "consists essentially of or consists of the amino acid sequence" of the corresponding SEQ ID. "By using the term 'consisting essentially of,' the drafter signals" that the claim may include "unlisted ingredients" (here additional amino acid residues) so long as they "do not materially affect the basic and novel properties of the invention." PPG Indus. v. Guardian Indus. Corp., 156 F.3d 1351, 1354 (Fed. Cir. 1998). In this regard, Appellants' claims allow for some variability from the precise amino acid sequence of mAb 11F6C4. One of skill in the art would not need to replicate an identical antibody to practice the claimed invention. For this reason, the evidence Appellant relies upon to try to overcome the presumption that Zhu is enabled is unpersuasive. See In re Morsa, 713 F.3d 104, 109 (Fed. Cir. 2013) ("[A] prior art printed publication cited by an examiner is presumptively enabling barring any showing to the contrary by a 7 Appeal2018-007790 Application 14/421,772 patent applicant or patentee."). Appellants rely on testimony in the inventors' section 1.132 declarations, stating that it would be impossible to "reverse-engineer" mAb 11F6C4 from the disclosure in Zhu. First Deel. ,r 6; Second Deel. ,r 7. 8 But, as explained above, one of skill the art does not need to replicate the identical antibody to practice the claims. And there is no evidence that undue experimentation would be required to follow the procedures taught in Zhu and its Supplemental Information to generate and identify an anti-cANGPTL4 antibody according to the same criteria that yielded mAb 11F6C4. See FFI. Indeed, Appellants appear to concede that doing so would be routine for one of ordinary skill. See App. Br. 10-11 (referring to "one of ordinary skill, following the process exactly as outlined in Tan and/or Zhu"). Moreover, whether the sequence for mAb 11F6C4 can be reverse- engineered by others is not the relevant inquiry for anticipation. As the Federal Circuit explained in Crish, "[i]t is irrelevant whether other workers" following the same procedures would "obtain[] a different sequence." 393 F .3d 1259. Here, Appellants are "claiming what [they] earlier disclosed," and we can "presume that [they] correctly sequenced" the CDRs of mAb 11F6C4. Id. Thus, Appellants' prior publication in Zhu of an antibody that they later sequenced and determined to contain those sequences anticipates their present claims to the same antibody. 9 Id. 8 Appellants submitted a third section 1.132 declaration with their Reply. That declaration relates to whether Appellants actually distributed physical specimens of mAb 11F6C4 to certain individuals. It does not provide any additional evidence regarding whether one of skill in the art could follow the procedures published in Zhu and its Supplemental Information. 9 Our analysis affirming the rejection over Zhu would likewise apply to 8 Appeal2018-007790 Application 14/421,772 For all these reasons, Appellants' arguments fail to persuade us that Examiner erred in rejecting the claims. Accordingly, we affirm the Zhu Rejection in full. New Ground of Rejection The Tan Rejection was withdrawn in Examiner's Answer. Ans. 4. We do not understand Examiner's rationale for doing so and therefore reenter the Tan Rejection now as a new ground of rejection pursuant to 37 C.F.R. Â§ 4I.50(b). Tan is prior art and it discloses the same mAb 11F6C4 antibody that Appellants concede is encompassed by their present claims. FF3; FF4. Like Zhu, Tan teaches the procedures that Appellants used to make and identify that antibody. FF4. The Tan Rejection is broader than the Zhu Rejection in that it addresses certain claims ( claims 15-18) not included in the Zhu Rejection. Appellants do not argue those claims separately from claim 1 in their Appeal Brief and, in any event, we find that Tan discloses the additional limitations of claims 15-18. FF5. Appellants briefed both rejections and we find their arguments regarding the Tan Rejection unpersuasive for the same reasons explained above regarding the Zhu Rejection. We enter a new ground of rejection of claims 1, 2, 15-18, 24 and 25 under 35 U.S.C. Â§ 102(a)(l) as anticipated by Tan. This new ground is the same as the previously-withdrawn Tan Rejection. We incorporate by anticipation rejection over Tan had that rejection not been withdrawn in Examiner's Answer. Like Zhu, Tan discloses the same mAb 11F64C antibody as well as the procedures Appellants used to make and identify it. See Tan 10-11, 52; FF3. 9 Appeal2018-007790 Application 14/421,772 reference Examiner's prior factual determinations in the Final Action concerning Tan as well as our analysis and findings above. For all these reasons, we determine that claims 1, 2, 15-18, 24 and 25 are anticipated by Tan. SUMMARY We affirm the rejection of claims 1, 2, 24 and 25 under 35 U.S.C. Â§ 102(a) as anticipated by Zhu. We enter a new ground of rejection of claims 1, 2, 15-18, 24 and 25 under 35 U.S.C. Â§ 102(a)(l) as anticipated by Tan. TIME PERIOD FOR RESPONSE This decision contains a new ground of rejection pursuant to 37 C.F.R. Â§ 4I.50(b). Section 4I.50(b) provides "[a] new ground of rejection pursuant to this paragraph shall not be considered final for judicial review." Section 41.50(b) also provides: When the Board enters such a non-final decision, the appellant, within two months from the date of the decision, must exercise one of the following two options with respect to the new ground of rejection to avoid termination of the appeal as to the rejected claims: ( 1) Reopen prosecution. Submit an appropriate amendment of the claims so rejected or new Evidence relating to the claims so rejected, or both, and have the matter reconsidered by the examiner, in which event the prosecution will be remanded to the examiner. The new ground of rejection is binding upon the examiner unless an amendment or new Evidence not previously of Record is made which, in the opinion of the examiner, 10 Appeal2018-007790 Application 14/421,772 overcomes the new ground of rejection designated in the decision. Should the examiner reject the claims, appellant may again appeal to the Board pursuant to this subpart. (2) Request rehearing. Request that the proceeding be reheard under Â§41.52 by the Board upon the same Record. The request for rehearing must address any new ground of rejection and state with particularity the points believed to have been misapprehended or overlooked in entering the new ground of rejection and also state all other grounds upon which rehearing is sought. Further guidance on responding to a new ground of rejection can be found in the Manual of Patent Examining ProcedureÂ§ 1214.01 (9th Ed, Rev. 07.2015, Nov. 2015). AFFIRMED; 37 C.F.R. Â§ 4I.50(b) 11 Application/Control No. Applicant(s)/Patent Under Patent Appeal No. 14/421,772 2018-007790 Notice of References Cited Examiner Art Unit Page 1 of 1 1644 U.S. PATENT DOCUMENTS * Document Number Date Name Classification Country Code-Number-Kind Code MM-YYYY A US- B US- C US- D US- E US- F US- G US- H US- I US- J US- K US- L US- M US- FOREIGN PATENT DOCUMENTS * Document Number Date Country Name Classification Country Code-Number-Kind Code MM-YYYY N 0 p Q R s T NON-PATENT DOCUMENTS * Include as applicable: Author, Title Date, Publisher, Edition or Volume, Pertinent Pages) Pengcheng Zhu et al., Angiopoietin-like 4 Protein Elevates the Prosurvival Intercellular 02 -.-H202 Ratio u and Confers Anoikis Resistance to Tumors, Cancer Cell, Vol. 19, 401--415 (2011) ("Zhu"). V w X *A copy of this reference 1s not being furnished with this Office action. (See MPEP Â§ 707.05(a).) Dates in MM-YYYY format are publication dates. Classifications may be US or foreign. U.S. Patent and Trademark Office PT0-892 (Rev. 01-2001) Notice of References Cited Part of Paper No. Cancer Ce!! 19 Supplemental Information AngiopoietinMlike 4 Protein Elevates the Prosurvival Intracellular 0 2--:H20 2 Ratio and Confers Anoikis Resistance to Tumors Pengcheng Zhu, Ming .Jie Tan, Royston-Luke Huang, Chek Kun Tan, Han Chung Chong, Mintu Pal, Chee Ren Ivan Lam, Petra Boukamp, Jiun Yit Pan, Suat Hoon Tan, Sander Kersten, Hoi Yeung Li, .feak Ling Ding, and Nguan Soon Tan 1 C ;16 : 14 0 ... ~12 ~ -~ 10 m E 8 tl .l!l ~ 6 OJ (I) :s 4 (I) 0, 2 m A 11_~. SI* â€¢ IA i ,._l:!f i . ,.. . ,:l. :i'i l' ,/Â· ,i:,,.t ..... ? ,,Â·Â· ......... H}\ .... ,HZ""- .Â·Â· s :,; ~.. /} :>< ,,. I ~ l .. Â·j()' Â·Â· 'Â·' , .. Â· i()()i,M . ~ ~ .. ~f H}':L-/ ......... ,....,.,..,--~ ' L:.~=-- 0,0001 O.O{rl {ttn il: k-:-:; (sÂ·{) anth:ANGPTL4 36 ll!f 1~~! -B'AS CNIJK BAX CASP1 CASP2 CD1{N1.4 BCL2t2 CASP10 Figure S2, related to Figure 2. Suppression of ANGPTL4 Reduces Tmnorigenicity and Exogenously Infused cANGPTL4 Accelerates Tum.or Growth j!,} > >- ~~ n; ~~.)!~ ~: ~~ :5 ?, g1 ~ i r.l () n; o),!:, 1 B t Â£~ ~ (Y. .,, <{> :;;Â· ,i ,;_1 "' "' ~~ ~ Â·:,; t O> Â·:, ,;!,_~ ~ lr, .. ]"- ::::; !- IY 2-fold) Up-regulated(> 2-fold) Gene A-SRT3cTRL A-SRT3ANGPHA Gene A-5RT3cTRL A-5RT3 ANGPTIA DJABLO 1.000 0.070 CASP7 1.000 1.927 CCNDl l.000 0.102 BID 1.000 2.051 CCNA2 1.000 0.119 BBC3 1.000 2.075 XJAP l.000 0.120 PE'RP 1.000 2.246 PCl\fA 1.000 0.17'7 PARPJ 1.000 2.308 COXJO l.000 0.223 PXN 1.000 2.947 BIRC2 1.000 0.247 BCL2Ll 1.000 3.112 1a67 l.000 0.269 CDKl\flC 1.000 3.609 BJRC3 l.000 0.345 FAS 1.000 6.171 CDK5 l.000 0.498 CHUK 1.000 6.353 lvlCLl l.000 0.500 BAX 1.000 8.363 CDK4 l.000 0.549 C:ASPJ 1.000 10.499 CASP2 1.000 10.560 CDI(NlA 1.000 1., e~~ .J.UJ I BCL2L2 1.000 14.671 CASPJO 1.000 24.740 Table S1, related to :Figure 2. Relative :Fold Change of Gene Expressions in A- 5RT3ANGPTL4-induced Tumors as Compared ""ith that of A-5RT3cm1Anduced Tumors Note: The gene expression levels in A-5RT3crnL-induced tumors are assigned value one. 5 A D Keratinocytes {Anoikis) vet1 fi pg/ml c:ANGPT!..4 10 pg/mi o\NGPT!.4 0.72 3-04 1 Â· U5it98 ll11 2.19 I 77.20 19.04! :~Â· j 82.D0!14 87 86.70 -~1.00 I:: ,-----,.~-----j I , il!/f/:::d i: ""~~~~~~ E Pre-coated wrt:1 ~ntegr:n avP5 F (J5 ~04- ~0 :1- 0 02 oÂ· 0.1 B C 0.00 11/JO ." i tftl [J:j tUl1 .................................. ''i :-, :~{ â€¢ ~ "Â· ,,, .. ~''""'(".'''", â€¢, .. : ::....""(' ....... ,-.. h, '''''"''''''Â·'Â· ,,, ...... ' .. " ...... "-Â· ..... ,-' .... -.,:Â· ........ ,.Â·,_.:Â·Â· ... ,.:i .... Â·Â·:' .... Â·Â·'' Â·) .11.nr.e:~m V Fl 1 \.., Â· G i100 ";:;; 80. ,::: ~ 60 iii 40 71J 20 f-'re-coated with 1r.t0grn1 ofi~ ': Q,.,,____,,_.,...---<-_r---< & H A-5RT3cm A-5RT3N,GCo:., --koa in!egrin~i-115 1 00 1,000 92 0.98 integrin 05-85 100 1,00 105 0.94 integrin (13 5 mo tao o.s-1 1.0a f3-tubul1n-55 g ,:::: 0 0 i5 OJ .,'-. ~ T n.s~ f'-"'-"-"': -T- KNK T n.s. r-1 T ~r OAT HACLÂ·t D B E ~ .. ; ~ Â·e, ., i\ II ~ ,~ :Lt.\ t I~ c-a:1tr0. \.~eh ~t.'qwi ~ .. i:. rxn l:.!i'Vf:-...:': ~f ~ ~":: ,~ t 1~ .. Â·Â· nr1nrr1t "neon .. ~....._~Â·~Â·'l<"-.Â·Â·Â·l\t'~~v\~..._"}\ ... / .... f,)..,...tÂ·~~~tÂ· ... ~Â·y\ ~ + h') ;,,, ~ ~ â€¢ 1', ~c:- No."~ ... Â· .. "::,'!-..\:...---"-Â·Â·' ... Â·~tÂ·/\.Â·~Â·Â· j;;.5 . ~ ~ C) roffi,onÂ·~vAJv,1~\.vy\r1dli \ 3 ,~\Â·"'AtÂ·.i\"l)1,.x",lÂ·\Â·\,Â·Â·'\Â·Â·Â·-'\.-,,, , , ~ ,. :: ~ iffi 6 .~Â·wÂ·<Â·Â·"Â·\.,.\ .... /,,r'~{Â·Â·Â·\w\,â€¢t\,,,.,., ~ ! ~+ 6 + Tiron .,{Â·..;,\~-.\\r'v-.;''Â°rÂ·'P\.,,""-...,,~\.,,~.~~:...\:v.;,t\~-.,:i,vl~.--i:-Â· f ~ j;; 6 + NoÂ»Â·l kd V,...,\.,V~,~,.,""-f,,<'Â·tvc,~,VÂ·Â·\'-'./;,,<,,1,/\.,! :: . . , . ~ .... n ~ {.)1 6 + OfÂ·"}~ 'r-.Â·..,.~Â· ....... /'"1Â·Â·~\...._, .. ,~ .... ~{-........ ~~"~t';,v"""',i',.Â·~\ ... ~ .. ~~y-.1',.:. f 5; 6 + :'Otenone ",...,,,"(.,.,.\ .. , .. \.,.A,.,...Atl1./';\,_,,.J\,.,, Ii l 3425 3'480 3:545 !\fagnetiG Field {Ga;JSS} Conlrol lgG ,Â·f.f41iUH .. :_.Â·i9D.5A~,~8 :,1,,,yÂ· D.1a11.S-s Â·Â·/029!27.66 .-â€¢Â·.' ..... ., ... _ ... .,-........... _ .. __ . Annexin V FlTC 8 J -Â© tv1DA,fv1B-231 g1 7 rnAb 11F6C4 m -~~-- tj e *. 236Bfl Ce~;pases K L Figure S4, related to Figure 4. ANGPTL4 Elevates the 0 2 - Level and Maintains a Relatively High 02-:H202 Ratio in Tumor Cells (A) Suppression of ANGPTL4 has no effect in the methionine/homocysteine metabolic cycle of tumor cells. Relative mRNA level ofBIJJHT, 111ATLA, AHCY, IGIK, OAT and HACLJ (representative genes in the methionine/homocysteine metabolic cycle) in A-5RT3ANGPTL4 and A-5RT3cTRL cells as determined by qPCR. (B) Immunoblot ofNoxl and Nox2 in A-5RT3crRL, A-5RT3 ANGPTL4 and MA-l\/IB-231 cells. p- tubulin served as a loading and transfer control. Representative blots of three independent experiments are sho;,vn. (C and K) Relative fold change in Noxl and Nox2 rnRNA and protein levels in i\-5RT3cTRL (scrambled control), A-5RT3Noxl (Nox1 knockdown) and A-5RT3Nox2 (Nox2 knockdown) cells (C), or in MDA-l\/1B-231cTRL (scrambled control), rv1DA-MB-231NoxJ (Noxl knockdown) and MDA-MB-23 l Nox2 (Nox2 knockdown) cells (K). (D, Hand L) Measurement of H20 2 levels using the Amp lex red assay in A-5RT3cTRL and A- 5RT3NoxJ cells (D), in MDA-MB-23lcTRL and MDA-rv1B-231Noxl cells (L); and in l\/IDA-MB- 231 cells treated with mAb 11 F6C4 (3 or 6 Fglml) or control IgG ( 6 Âµ.g/rnl) (H). Arbitrary relative 02-J:b02 ratios are shown in boxes (J\ (E) Representative EPR spectra ofDEPMPO-superoxide spin adduct from MDA-MB-231 cells in the absence or presence of indicated chemicals or inhibitors. M DA-MB-231 cells were treated with mA_bl 1F6C4 (3 or 6 ).lg/ml) or control IgG (6 p.g/ml). In indicated experiments, MDA-l\/IB- 23 l cells were transiently transfected with ON-TARGETplus siRNA (Dharmacon) against either Noxl (Nox1 kd) orNox2 (Nox2 kd). The superoxide adduct ofDEPMPO has hyperfine splitting constants ofaN=13.13 G; ap=55.61 G; a1\r=13.11 G; aYg=0.71, 0.42, 0.7, 0.25, and 0.6 G. (F) EPR signal intensity at 3480 G from MDA-MB-231 cells in (E). Tiron-treated measurement served as a negative signal control. (G) l\/leasurement of 0 2 levels using the MCLA assay in MDA-MB-231 cells treated with mAb11 F6C4 (3 or 6 Âµg/ml) or control igG (6 ilg/ml) in the absence or presence of the indicated chemicals or inhibitors. 9 CO Percentage of apoptotic MDA-1'.U3'-23 l after 2 h of anoikis as analyzed by FA.CS (5000 events). Apoptotic index is described in Figure 38. Values (bold) denote apoptotic cells(%) from three independent experiments. (J) Relative activities of caspases 2, 3, 6, 8 and 9 in rnAb 11 F6C4-treated MDA-M B-231 cells after 2 h of anoikis. Values ( means Â± SD) are from three independent experiments perfom1ed in triplicate. *p < 0.05; **p < 0.01. Fold-increase in caspase activity was calculated by comparison to pre-irnrnune IgG-treated MDA-MB-231 cells. (A, C and K) Error bars represent SD from three independent qPCR experiments performed in triplicate. Ribosomal protein L27 (L27) v,.ras used as a reference housekeeping gene. (D-H and L) Values \Vere normalized to total proteins and presented as meansÂ± SEM. Data \Vere frorn three independent experiments performed in triplicate. *p < 0.05; **p < 0.01; ***p < 0.001; n.s. represents not significant. (E-G) Vehicle-treated M DA-MB-231 eel Is in the presence of control IgG (6 Âµg/ml) serve as cognate controls. 10 A ** veh DP! 3 6 8t1 Control lt:iG rnAb 11 F6C4 (6 pfi/mt) (pg/rnl) HSC w {Squamous Cell Carcinoma) +~ Â§ (/)14 :c ro12 O'> 010 ::i S 8 -~: 6 -a~ 4 & 2 0 vel1 OP! 3 6 !3p1 CQ:ntrol lgG mAb11 F6C4 (b pglmT) (pg/ml) huH-1 (Hepatoma} veh DP! 3 6 BPI Control !gG mAb11F6C4 (6 iig/m{J (J.ig/m!J !!-4 2 8 'C: T24 (f?!adder Carcinoma) (Squmnous Ce!! Carcinoma) $ 14 . . 6+ veh DPI 3 6 QP! Cgnlrof !gG mAb11F6C4 (6 pgimTJ (pÂ£1!m!) ::) V, 1: ~ 6 ->;Â· 0)(.) ::i ,., Jj*â€¢..JIL.. 8 anatomic sites. The two tissue arrays were probed with the anti-cANGPTL4 polyclonal antibody fr.)llowed by Alexa488 goat-anti-rabbit IgG. Irnages vvere taken using MIRAX MIDI with Plan-Apochromatic 20x/0.8 objective (with equal exposure and gain), and each image was automatically stitched using MIRAX Scan software (Carl Zeiss). The 3D heatmaps were generated using IMARIS software (Bitplane Scientific Software). In the heatmaps, the X- and Y- axes represent the length and width, whereas the Z axis represents the IF intensity. The gray 14 value (IF intensity) was obtained from three biopsies using TissueQuest software (TissueGnostic GmbH). Laser Capture Mkrodissection (LCM) For LCJ\/1 samples, epithelial and stromal fractions were microdissected from 8-~tm-thick sectioned tissues using a PALM Micro beam Axio Observer Zl (Carl Zeiss). LCM tissues were collected into rnicrofuge tubes with opaque AdhesiveCaps (Carl Zeiss). RNA was extracted using Optimum TM FFPE RNA Isolation kit (Ambion) pooled from eight LCM tissues. Five ng of RNA was amplified using a Full Spectmm Complete Transcriptome RNi\ Amplification kit (System Biosciences) prior to qPCR as previously described (Chong et al., 2009; Gob et al., 2010a, 2010b). Cell Culture HaCaT is an immortalized hut non-tumorigenic human keratinocyte line. II-4 and A-5RT3 are turnorigenic HaCaT derivatives kindly provided by the German Cancer Research Center (DKFZ, Germany). HSC is a human squamous cell carcinoma line provided by Prof Aso (Yamagata University School of Medicine, Japan), and MDA-MB-231 (breast adenocarcinoma) by Dr. Lin (Nanyang Technological University). Other lines used were murine melanorna B16F10 and human tumor lines used were Alexander (malignant hepatoma), A549 (lung carcinoma), Hela (cervix adenocarcinoma), huH-1 (hepatorna), Kato m (stomach signet ring cell carcinoma), MCF7 (breast adenocarcinoma) and T24 (bladder carcinoma). All cells vvere rnaintained in Dulhecco 's modified Eagle's medium (DMEM; Hyclone, USA) supplemented with 10%i heat- inactivated fetal bovine serum (FBS, Hyclone), except for A549, huH-1, Kato lII which were maintained in RPMI-1640 (Hyclone) with 10% FBS. Cells were cultured at 37 Â°C, 5%) CO2 and 75%) humidified incubator. Suppression by RNA Interference (RNAi) siRNAs against human ANGPTL4, mouse ANGPTL4, Nox1, Nox 2 and a scrambled sequence as control (control siRNA) were subcloned into the pFIV-H1/U6-puro pFIV/siRNA lentivirns system. The correct pFlV siRNA constructs were verified by sequencing using H 1 primer. The sequences are shown in table below. Pseudovirns purification and transduction were performed (Chong et al., 2009). ANGPTL4-knockdown tumor cells were enriched by puromycin selection for 1 week. The A-5RT3 sub-cell line designated A-5RT3."'NGPTL4, "I.Vith the highest knockdown efficiency "I.Vas chosen in this study, and the non-targeted siRNA transduced line vvas denoted as A-5RT3crnL- The expression of endogenous ANGPTL4 in MDA-MB-231 cells was also suppressed using tetracycline-inducible pSingle-tTS-shRNA vector (Clontech). ANGPTL4 set 2 shRNA sequences were used (see table below), Knockdmvn efficiency of ANGPTIA and relative expression level of indicated genes "I.Vere determined by qPCR and immunoblot. Table. Sequences of ANGPTL4, Noxl, Nox2 and Control siRNAs. siRNA Sense Primer (5' ----> 3') Antisense Primer (5' ---'> 3') ANGP1L4 ,et 1 Â·â€¢ Af.\f\GCTGCAAGATGf\CCTCAGATGGAGGCTG AIV\ACAGCCTCCATCTGAGGTCf\ TCTTGCAG TCGAGGCAGCACCTGCGAATTCAGCATCTGCA AGCTTACGCGTAAAAAGCAGCACCTGCGAATT ANGPTL4 set 2â€¢ TTCAAGAGATGCAGATGCTGAA TTCGCAGGTG CAGCATCTGCATCTCTTGAATGCAGATGCTGA CTGCTTTTTTACGCGTA ANGPTL4 ,et., AA/1..GCAGCAGGATCCJ.\GCf\ACTCTTCCACf\A ANGPTiA set 4 AAAGGCTTAAGAAGGGAATCTTCTGGf\AGAC ATTCGCAGGTGCTGCC AAAATTGTGGAAGAGTTGCTGGATCCTGCTG f\AAAGTCTTCCAGAAGATTCCCTTCTTAAGC Nnxl AAAGGGCCACAGATGGCTCCCTTGCCTCCAT AAAr'IJ.\TGGAGGCt~\GGGAGCCATCTGTGGCC 15 Nox2 AAAGGGCCAGATGTTCTTTCTACAGAAGAAT AAAAATTCTTCTGTAGAAAGAACATCTGGCC Mou,eANGPTJA AAAGCTGTGAGATGACTTCAGATGGAGGCTG AAAACAGCCTCCATCTGAAGTCATCTCACAG Conlnil slRNA AAAGCTGTCTTCAAGCTTGATATCGAAGACTA AAAATAGTCTTCGATATCAAGCTTGAAGACAG *ANG-PT/A Set 1 siRNA used for lentivirus-mediated RNA interference. # ANGPTL4 set 2 shRNA was cloned into pSingle-tTS-shRNA vector (Clontech) and used for doxycycline-inducible knockdown in 1'.1IDA-MB-231 cells. Rho GTPases Assay Active OTP-bound Rael was quantified as previously described (Tan et al., 2009) with minor modifications. Briefly, 500 Âµg of the indicated tumor biopsies lysates were incubate with 2 Âµg of configuration-specific monoclonal anti-Rac1-GTP antibody (GTP-Racl; NewEast Biosciences). OTP-Rael-bounded antibodies were inm1Unoprecipitated with Sepharose Protein G/A beads. Bound proteins were solubilised in Laemmli's buffer, resolved by SDS-Pi\GE, and irnmunoblotted using polydonai antibody against Rael. Total Rael was detected using total lysate. Anti-Rael antibodies for immunblot were from Cytoskeleton Inc. Membrane Protein Extraction HEK293T cells were transfected "I.Vith either empty mammalian expression vector pEF 1-mycA (Invitrogen) or vector carrying cDNAs encoding human integrins p 1, 03 and ~5 by means of ExGen 500. Forty-eight hours post-transfection, cell membranes were first isolated using ProteoExtractNative Protein Extraction Kit (Calbiochem) and subjected to enrichment by sucrose step gradient (Tang, 2006). The proteins were dialyzed against PBS prior to SPR analysis. Immunoblot Analysis Total protein was extracted from cells or tumor tissues/cells with ice-cold lysis buffer (20 rnM Na2H2P04, 250 mM NaCl, 1 %1 Triton-I 00, 0.1 ?-Â·~ SDS). Equal amount of protein extracts were resolved by SDS-PAGE and eiectrotransferred onto PVDF membranes. Membranes were processed according to standard procedure and proteins were detected by chemiluminesence (Millipore, USA). 0-tubuiin was used as loading and transfer control. Detection of Src Oxidation by Carboxymethylation The detection of reduced Src v,.ras performed as described (Giannoni et al., 2009) with minor modifications. Cells \Vere subjected to anoikis as described above. At the indicated time, cells were then lysed with 500 ~tl lysis buffer (50 mM Tris-HCI, pH 7.5, 150 mM NaCl, 0.5%> Triton X-100, 10 p,g/ml aprotinin and 10 Âµ.g/ml leupeptin) containing 100 ,uM !V-(biotinoyl)-!V- (iodoacetyl) ethylenediamine. Lysates were clarified by centrifugation and c-Src vw1s immunoprecipitated using specific anti-c-Src antibodies. Immunocomplexes were resolved by SDS-PAGE and the biotinylated/reduced fraction of Src kinase was detected with horseradish peroxidase (HRP)-conjugated streptavidin and chemiluminesence. Electron Paranrngnetic Resonance (EPR) Measurement of 0 2- Entire excised tumor biopsies were enzymatically dispersed into single cell suspensions. The tissue was minced and incubated in digestion buffer containing 1 mg/ml hyaluronidase, 1 mg/ml collagenase D and 100 unit/rnl DNase (Sigma-Aldrich) in a 37Â°C shaking incubator for 2 h. The dispase and hyaluronidase digests were pooled and filtered through a 70 Âµm Nylon cell strainer. Cells were washed, pelleted and resuspended in PBS containing 3~~ FBS. Equal numbers of cells 16 were used for EPR measurement of 0 2-. Direct trapping of superoxide in aqueous media was perfonned using the spin trap DEPMPO, which fonns a relatively stable superoxide adduct. EPR spectra were recorded at room temperature with a Bruker D-200 ER spectrometer, operating at X-band with a Tl\.11 110 cavity with a quartz flat cell. The EPR parameters were set at 100 KHz, X-band microwave frequency, 9.5 GHz; microwave power, 20 m\V; modulation amplitude, 1 G; time constant, 160 s; scan time, 50 s; and receiver gain, 5 x 105. The EPR spectra represent the averaged signals of 10 scans. EPR signal amplitude at 3480 G represents the pure line corresponding only to the superoxide adduct All experiments were performed in triplicates. Total RNA Isolation and Quantitative Real-time PCR (qPCR) Total RNi\ was extracted and qPCR "I.Vas performed Expression "I.Vas related to the housekeeping gene 60S ribosomal protein L27 (L27) which did not change under any of the experimental conditions studied. The sequence of primers is available in the table below. For focused mRNA array, genes whose expression was changed significantly (> 2-fold) were listed and heatmaps ;,vere generated using Orange Canvas 1.0 software. Table. Sequences of qPCR Primers. I GenBank 1 Official I Sense Primers (5' --+ 3') 1 Antisense Primers (5' --+ 3') 1 ~ ~ ~1 I ~ ~ I Accessmn j Svmhol I ! ! ~ ~ " I ~ ~ ~ ............................................................................................................ ~.._ ........................................................................ ,t .......................................................................................................................................................................................................................................... ~ ....................................................................................................................................................................................................................................... ~ ! NlvI 004324 j BAX ! GGGTGGTTGGGTGAGACTC ! AGACACGTAAGGAAAACGCATTA ! ~ ..................... Â·-- ........................................................................... ~ ........................................................................... ,t .......................................................................................................................................................................................................................................... ~ ....................................................................................................................................................................................................................................... ~ ! NM 014,i 17 j 8BC3 ! GACCTCAACGCACAGTACGAG ! AGGAGTCCCATGATGAGATTGT ! I NM--1'8"~8 """"'"TBcr 2l '""'"' ITCCCTCC \ \L\C{'CT\C L\" \c\c"""'" i C{'TCCTCC1\TTCTTCCC \T \ """"""' 1 ~ ....................................... .) ... _.,, I ............................................. ~ .......... __ _.,, ...... _.,, l ........................ ~ ............. J _.,, J ......... J! ... JJ: ... ! ... .,f ......... J! ... / ... J ...... 1: ...... _J.,1 ...... \. L ... 1 ......... J ........................ ~ .... J! ... / ............ J _.,, ......... J __ ............................ J .................. / ... / ... _.,,1: ............ L ................................................ ~ ! NM 004050 I BCL2L2 ! GCGGAGTTCACAGCTCTATAC I AAAA.GGCCCCTACAGTTACCA I ::- .............................................................................................................. ~ ...................................................................... ~ ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................. . ! NM 001196 I BID ! GACAGCATGGACCGTAGCATC ! AGGTGCGTAGGTTCTGGTT.A.ATA ! ::- ...................... - .............................................................................. ~ ...................................................................... ~ ........................................................................................................................................................................................................................................ t ........................................................................................................................................................................................................................................ ~ ! NM 001166 j LURC2 ! GTTTCAGGTCTGTCACTGGAAG ! TGGCATACTACCAGATGACCA ! ~ ........................ ---.............................................................................. *- .......................................................................................................................................................................................................................................................................................................................... ,t... ....................................................................................................................................................................................................................................... ,t ! NM J 82962 j LURC3 ! TCCTGGATAGTCTACTAACTGCC ! GCTTCTTGCAGAGAGTTTCTGAA ! i Â·NÂ·~, "()'P2l)~ """'""i Â·..., Â·' "l,, --------- i Â·1Â·c'" \ ,, 'f /\ \"lY'C'-\C' /\ \cÂ·Â·r'C', \C'"( Â· â€¢ t cÂ·c"rc'1Â· \C'C'C'C'\cÂ·Â· /\1"f'I"J'C"r â€¢tÂ·Â·Â·cÂ· /\ " l ~ JVl -- .) . L ~ l/./l>) f \ _.,,\_ { 1Â·\. .,1"\._{ '...J J! /.,t"\._{ J _.,,j:\._f J\ . . â€¢ \ J _.,1 J / / / _.,1 _.,,j-\. J.,1"\._ J J:"\. _J /.,t"\._ \ i Â·NÂ·l\1 ___ 0(} i 2Â·~0 """"" i Â·c-Â· ,'S'D IÂ·)"'"" i ", "'"I'(--,-.. I'('('r' '',, râ€¢ ;'('"I'(-,;.' Ac-Â·,, râ€¢ "" l Â·JY"I"IY'('("I'(''I"I"I'(''I'r'r' ,\("I'("I' """'""l ~ â€¢â€¢ - , ./-' t.. .l. â€¢ l \ i\ l _I'-J ./ _,,\_,J\1Â·\.\_L'--\. ./.f-1... _L-V1.. J1Â·\.\_,, , '-J '--Â· ./ ./ .J .J \_,,,____ ./ ./ , L NM-032982 ___________ J.c>1sP2 __________ l.AAA.CGAGGTTCCTGGTACATCG _____ J TCCTTGATAAGTGCGTTCACC __________ j ! NM 033340 j CASP7 ! AGTGACAGGTATGGGCGTTC ! GAGGTTGCAGTCTTCCGAGAT ! ~ ........................ Noble agar in DMEM with 10% FBS on top. Tumor-cell colonies were stained with 1 mg/rnl thiazolyl blue tetrazolium in PBS after 4 weeks. Cells were subjected to an anoikis assay. Briefly, anoikis was induced by forced suspension, wherein 5.0 105 cells were seeded onto l.Qi;;;i serum-free DME1'.1I equilibrated agarose in the presence of either 10 Âµg/rnl of pre-immune IgG orrnAbllF6C4. For MBA-MD-231, the cells were exposed to 1 ~tg/ml doxycyline for 24 h to knockdown ANGPTL4 prior anoikis. For rescue experiments, cells were subjected to anoikis in the presence of either the indicated concentrations of exogenous recombinant cANGPTL4 or vehicle (PBS). Cells were harvested at the indicated time points, and analyzed for apoptosis by FACS analysis. The apoptotic indices of attached cells were determined immediately after harvesting v,.rith trypsin. Caspase Activity Assay Cells \Vere subjected to anoikis as described above. The activities of caspases 2, 3, 6, 8 and 9 ,vere measured with Apotarget caspase colorimetric protease assay kit (Biosource International, Camariilo,CA) according to the manufacturer's instructions. The O.I).4osnm was measured, and the fold increase in caspase activity vw1s determined by direct cornparison with the level of the A- 5RT3crnL or cognate pre-immune IgG treated cells. 18 Supplemental References Cornrnittee on Methods of Producing Monoclonal Antibodies, Institute for Laboratory Animal Research, and Council, N.R., ed. (1999). Monoclonal Antibody Production. Goh, Y.Y., Pal, M., Chong, H.C., Zhu, P.C., Tan, M.J., Punugu, L., Lam, C.R.I., Yau, Y.H., Tan, C.K., Huang, R.L., Tan, S.M., Tang, M.B.Y., Ding, LL., Kersten, S. and Tan, N.S. (2010a). Angiopoietin-like 4 interacts with integrins !31 and BS to rnodulate keratinocyte migration. Am. J. Pathol. 177, 2791-2803. Goh, Y.Y., Pal, M., Chong, H.C., Zhu, P., Tan, M.J., Punugu, L., Tan, C.K., Huang, R.L., Sze, S.K., Tang, l\/1.B.Y., et al. (2010b). Angiopoietin-like 4 interacts with matrix proteins to modulate wound healing. J Biol Chern 28.5, 32999-33009. Tang, V.W. (2006). Proteomic and hioinformatic analysis of epithelial tight junction reveals an unexpected cluster of synaptic molecules. Biology direct 1, 37. 19