Ex Parte Harris et al

Patent Trial and Appeal Board

Dec 11, 2017

13277076 (P.T.A.B. Dec. 11, 2017)

United States Patent and Trademark Office
UNITED STATES DEPARTMENT OF COMMERCE
United States Patent and Trademark Office
Address: COMMISSIONER FOR PATENTS
P.O.Box 1450
Alexandria, Virginia 22313-1450
www.uspto.gov
APPLICATION NO. FILING DATE FIRST NAMED INVENTOR ATTORNEY DOCKET NO. CONFIRMATION NO.
13/277,076 10/19/2011 Delbert Linn Harris 24290-US-NP 4383
210 7590
MERCK
P O BOX 2000
RAHWAY, NJ 07065-0907
EXAMINER
CHESTNUT, BARRY A
ART UNIT PAPER NUMBER
1648
NOTIFICATION DATE DELIVERY MODE
12/18/2017 ELECTRONIC
Please find below and/or attached an Office communication concerning this application or proceeding.
The time period for reply, if any, is set in the attached communication.
Notice of the Office communication was sent electronically on above-indicated "Notification Date" to the
following e-mail address(es):
US-DOCKET-PATENT@merck.com
PTOL-90A (Rev. 04/07)
UNITED STATES PATENT AND TRADEMARK OFFICE
BEFORE THE PATENT TRIAL AND APPEAL BOARD
Ex parte DELBERT LINN HARRIS, MATTHEW ERDMAN, KURT IVER
KAMRUD, JONATHAN SMITH, JOHN DUSTIN LOY, LYRIC
COLLEEN BARTHOLOMAY, and ED SCURA
Appeal 2016-0079501
Application 13/277,0762
Technology Center 1600
Before DONALD E. ADAMS, RYAN H. FLAX, and DAVID COTTA,
Administrative Patent Judges.
ADAMS, Administrative Patent Judge.
DECISION ON APPEAL
This appeal under 35 U.S.C. § 134(a) involves claims 1, 2, 5—10, 20-
24, and 30-40 (App. Br. 1). Examiner entered rejections under 35 U.S.C.
§ 103(a). We have jurisdiction under 35 U.S.C. § 6(b).
We AFFIRM-IN-PART and enter a new ground of rejection.
1 This Appeal is related to pending Appeal 2016-008109 (Application
13/736,184) and pending Appeal 2017-002816 (Application 13/657,895)
(see App. Br. 1).
2 Appellants identify the real party in interest as “Harrisvaccines, Inc.”
(App. Br. 1).
Appeal 2016-007950
Application 13/277,076
STATEMENT OF THE CASE
Appellants disclose “[a] method of producing a vaccine . . . which
protects [an] animal from adverse effects of a pathogenic microorganism”
(Spec. 4: 19—20). Independent claims 1 and 35 are representative and
reproduced below:
1. A method of producing an autogenous vaccine to protect a
second animal from a first biotype of a microorganism, the
method comprising,
a) obtaining a biological sample from at least one first animal
where said first animal has been exposed to said first biotype of
said microorganism and wherein said microorganism is subject
to shift or drift;
b) selecting a first nucleic acid molecule of interest or fragment
thereof (NOI) from said microorganism known to be capable of
producing a protective response to a different biotype from said
first biotype of said microorganism in the same species as the
second animal;
c) amplifying a second NOI with said first NOI sequence from
said biological sample without the need to isolate said
microorganism;
d) producing a protective molecule comprising a[] RNA particle
comprising a nucleic acid molecule comprising or produced
from said second NOI sequence;
e) producing a vaccine comprising said protective molecule,
wherein said protective molecule does not comprise said
microorganism or a replicable or living pathogenic
microorganism; and
[f]) providing said protective molecule in said vaccine in an
amount that when administered to said second animal, produces
a protective response specific to said first biotype of said
microorganism in said second animal.
(App. Br. App’x IX 1.)
2
Appeal 2016-007950
Application 13/277,076
35. A method of producing an autogenous vaccine to protect a
second animal from a disease caused by a first biotype of a
microorganism under conditions safe for vaccination of a food
production animal, the method comprising,
a) selecting a first nucleic acid molecule of interest or fragment
thereof (NOI) of said microorganism known to be capable of
producing a protective response to a different biotype from said
first biotype of said microorganism in the same species as the
second animal;
b) obtaining a biological sample from at least one first animal
where said first animal has been exposed to said first biotype of
said microorganism and wherein said microorganism is subject
to shift or drift;
c) amplifying a second NOI with said first NOI sequence from
said biological sample without the need to isolate said
microorganism;
d) producing a nucleic acid molecule which comprises or is
produced from said second NOI sequence;
e) testing an RNA vector to determine if it reverts to virulence
in the species of said second animal and selecting said RNA
vector if it does not revert to virulence in the species of said
second animal;
f) producing from said RNA vector a protective molecule
comprising an RNA particle and said nucleic acid molecule
which comprises or is produced from said second NOI
sequence wherein said protective molecule is safe for producing
a vaccine for food production animals and does not comprise
said microorganism or a replicable or living pathogenic
microorganism; and
g) producing a vaccine comprising said protective molecule,
said protective molecule capable of being produced in less than
three months from the time of obtaining said second NOI, said
vaccine, when administered to said second animal, produces a
protective response specific to said first biotype in said second
animal.
(App. Br. App’x IX 3—4.)
3
Appeal 2016-007950
Application 13/277,076
The claims stand rejected as follows:3
Claims 1, 2, 5—10, 20-24, and 31—40 stand rejected under 35 U.S.C.
§ 103(a) as unpatentable over the combination of Lapointe,4 Liljestrom,5
Davis,6 Erdman,7 and Deng.8
Claim 30 stands rejected under 35 U.S.C. § 103(a) as unpatentable
over the combination of Lapointe, Liljestrom, Davis, Erdman, Deng, and
Swenson.9
3 We recognize the provisional obviousness-type double patenting rejection
in Examiner’s Final Action (see Final Action 16—17). On this record, the
status of this rejection is unclear (see, e.g., Ans. 2). In addition, neither
Examiner nor Appellants presented this rejection for review in this Appeal
(see Ans. 2—19; App. Br. 4). Therefore, we did not include this rejection in
our deliberations. In the event of further prosecution, we encourage
Examiner and Appellants to work cooperatively to resolve the status of this
rejection.
4 L. Lapointe et al., Antibody response to an autogenous vaccine and
serologic profile for Streptococcus suis capsular type 1/2, 66 The Canadian
Journal of Veterinary Research 8-14 (2002).
5 Peter Liljestrom and Henrik Garoff, A new generation of animal cell
expression vectors based on the semliki forest virus replicon, 9
Biotechnology 1356-1361 (1991).
6 Nancy L. Davis et al., Alphavirus replicon particles as candidate HIV
vaccines, 53 iubmb Life 209—211 (2002).
7 Matthew M. Erdman et al., Virus-like replicon particle co-expression of
PRRSV GP5 andMproteins, Animal Industry Report AS 653, ASL R2175
(2007).
8 Ming Y. Deng et al., Comparison of six RNA extraction methods for the
detection of classical swine fever virus by real-time and conventional
reverse transcription — PCR, 17 J. VET Diagn Invest 574—578 (2005).
9 Sabrina L. Swenson, DVM, Ph.D. and Gene A. Erickson, DVM, Ph.D.,
Swine Influenze Virus, 1 Swine Health Fact Sheet (1999).
4
Appeal 2016-007950
Application 13/277,076
ISSUE
Does the preponderance of evidence relied upon by Examiner support
a conclusion of obviousness?
FACTUAL FINDINGS (FF)
FF 1. Lapointe discloses “[a]n autogenous vaccine [] developed, using
sonicated bacteria, with a strain of Streptococcus suis capsular type 1/2”
(Lapointe, Abstract; see also id. at 10: second column, second full paragraph
(“The vaccination trial was performed in a farrow-to-fmish, high health
status herd where clinical signs associated with infection with S. suis type
1/2 had been observed in piglets of 6 to 8 [weeks] of age”); id. at 10: first
column, second full paragraph (Lapointe discloses the use of a “pilot study
... to determine the appropriate dosage for the vaccine and to evaluate any
adverse effects”); see generally Ans. 3—4).
FF 2. Lapointe discloses that “[t]he strain of S. suis capsular type 1/2 used
for the autogenous vaccine (strain #97-4114) originated from a pig that had
died suddenly in a herd of 6- to 8-week-old pigs with clinical signs of S. suis
infection” and that “[t]his strain, along with 5 other strains of S. suis type 1/2
isolated from pigs in the same herd and other herds belonging to the same
owner, were compared by randomly amplified polymorphic DNA (RAPD)
with primers OPB07, OPB10 and OPB17” (Lapointe 9: col. 1, fourth
indented paragraph; see generally id. at 10: col. 2, second indented
paragraph (“The strain used in the autogenous vaccine originated from that
herd”); Ans. 3—4; see Spec. 1: 4—6 (“[different isolates can be biotyped . . .[,
wherein] a variant of the pathogenic agent is distinguishable by a particular
characteristic over other members of the pathogenic species . . ., for
5
Appeal 2016-007950
Application 13/277,076
example, by sequence variation of a DNA sequence, RNA sequence,
pathogenic response, serological type or the like”)).
FF 3. Examiner finds that Lapointe fails to disclose the selection of “a
nucleic acid molecule of interest (NOI) that produces a protective molecule
comprising a[] RNA particle comprising a nucleic acid molecule comprising
or produced from [the] NOI” (Ans. 4).
FF 4. Deng discloses that “reverse transcription—PCR (RT-PCR) is a
valuable technique that is increasingly being used for diagnosis of animal
diseases caused by RNA viruses, including classical swine fever virus
(CSFV)” and that “[r]apid and accurate detection of CSFV is critical for
disease containment” (Deng 574: col. 1, first paragraph (endnotes omitted);
see generally Ans. 6—7 (Examiner explains that the technology (i.e., RT-
PCR), as disclosed by Deng, for producing a second nucleic acid strand that
is complementary to a first nucleic acid strand was known and
conventionally used by those of ordinary skill in this art at the time of
Appellants’ claimed invention)).
FF 5. Liljestrom
developed a novel DNA expression system, based on the
Semliki Forest virus (SFV) replicon, which combines a wide
choice of animal cell hosts, high efficiency and ease of use[,
wherein] DNA of interest is cloned into SFV plasmid vectors
that serve as templates for in vitro synthesis of recombinant
RNA.
(Liljestrom 1356: col. 1,11. 1—8 (emphasis added); id. at 1356—1357:
bridging sentence (Liljestrom’s “RNA can be used both for direct
transfection of cells as well as for production of recombinant virus that only
expresses the heterologous portion of a recombinant”); see Ans. 4.)
6
Appeal 2016-007950
Application 13/277,076
FF 6. Liljestrom discloses that “[a] major advantage of the SFV system is
that a high titer recombinant vims stock can be produced by a single
(overnight) transfection experiment. There is no need for tedious
selection/screening, plaque purification or amplification steps for the
production of a recombinant vims stock” (Liljestrom 1360: col. 2, second
indented paragraph; see Ans. 4).
FF 7. Examiner finds that Liljestrom “does not explicitly state the
utilization of a replicon for producing a composition that produces a
protective molecule comprising a nucleic acid molecule” (Ans. 4).
FF 8. Davis relates to the use of “Alphavims Replicon Particles as
Candidate HIV Vaccines” (Davis, Title).
FF 9. Davis discloses:
Replicon particles based on Venezuelan equine encephalitis
vims (VEE) contain a self-replicating RNA encoding the VEE
replicase proteins and expressing a gene of interest in place of
the viral stmctural protein genes. Stmctural proteins for
packaging of replicon RNA into VEE replicon particles (VRPs)
are expressed from separate helper RNAs. Aspects of the
biology of VEE that are exploited in VRP vaccines include
1) expression of very high levels of immunogen, 2) expression
of immunizing proteins in cells in the draining lymph node, and
3) the ability to induce mucosal immunity from a parental
inoculation.
(Davis 209: first paragraph (emphasis added); see Ans. 4.)
FF 10. Davis discloses that their “results and previous results in the SIV-
macaque model [] have led to the preparation of a South African clade C
Gag-expressing VRP vaccine” (Davis 210: col. 2, last paragraph).
FF 11. Erdman discloses the constmction of “[v]ims-like replicon particles
(VRP) derived from the alphavims Venezuelan equine encephalitis (VEE)”
“that co-express porcine reproductive and respiratory syndrome vims
7
Appeal 2016-007950
Application 13/277,076
(PRRSV) GP5 and M proteins[, which] form a heterodimer” (Erdman, col.
1, first and second paragraph; see id. col. 1, last paragraph (“VRP can co­
express PRRSV GP5 and M proteins in heterodimer form. This work
supports the in vivo evaluation of GP5-M VRP as a novel vaccine for
PRRSV. Vaccination-challenge trials in pigs are in progress”); Ans. 5).
FF 12. Erdman’s Figure 1 is reproduced below:
Erdman’s Figure 1 illustrates the “[djesign of [a] replicon co-expressing
PRRSV G5 and M proteins” (Erdman Figure 1 title; see Ans. 5).
FF 13. Appellants’ Figure 8 is reproduced below:
Appellants’ “Figure 8 is a map of the vector pERK-3/M/GP5” (Spec. 5: 12;
see Ans. 16 (Appellants’ Figure 8 and Erdman’s Figure 1 “both represent the
8
Appeal 2016-007950
Application 13/277,076
identical replicon vector construct, whereby Appellants] identity] the
construct as an falutogenous replicon particle (ARP)”); see also Ans. 5).
FF 14. Examiner finds that the combination of Lapointe, Liljestrom, Davis,
Erdman, and Deng fail to disclose “swine influenza virus” (SIV) (Ans. 13).
FF 15. Swenson discloses:
Swine influenza virus [(SIV)] is an orthomyxovirus with a
segmented RNA genome. Orthomyxoviruses are divided into
three groups as type A, type B, or type C. Only type A viruses
infect pigs. The type A viruses are further subtyped based on
their hemagglutinin (H) and neuraminidase (N). There are 15
hemagglutinins (HI-HI5) and 9 neuramindases (N1-N9) that
have been identified in humans, animals, and birds. Due to the
segmented genome, genetic reassortment can occur between
different subtypes, resulting in antigenic shift when H and N
genetic material are exchanged between viruses. In addition,
antigenic drift can occur due to accumulation of point mutations
in genetic material, which is common in RNA viruses.
(Swenson, second paragraph; see generally Ans. 13.)
FF 16. Swenson discloses that “[v]irus isolates can be typed to determine
the H and N components, which is important for determining the type(s) of
SIV vaccine to use in a herd” (Swenson, ninth paragraph; see generally Ans.
13).
FF 17. Swenson discloses that “[d]ue to the antigenic differences between
H1N1 SIV and H3N2 SIV, vaccines containing H1N1 SIV are not expected
to be protective with H3N2 SIV infections. Therefore, an H3N2 vaccine
will need to be used. Options for vaccination include autogenous or
commercially available vaccines” (Swenson, last paragraph; Ans. 13).
9
Appeal 2016-007950
Application 13/277,076
ANALYSIS
Persons skilled in the art of producing animal vaccines prior to
. . . [Appellants’ asserted priority date, i.e., October 27, 2010,]
understood that autogenous (farm specific) vaccines are whole
microorganism vaccines produced by culturing the organism
from dead or diseased animals, and then administering killed
versions of the organisms to animals in the same farm.
(Halbur Dec.101 5; see also App. Br. 9 (“experts state that prior to October
27, 2010, persons skilled in the art of producing animal vaccines understood
that autogenous, farm specific vaccines are whole microorganisms,” such as
those disclosed by Lapointe).)* 11 For example, Lapointe discloses the
development of an autogenous vaccine, using sonicated bacteria that
“originated from a pig[, i.e. a food production animal,] that had died
suddenly in a herd of 6- to 8-week-old pigs with clinical signs of S. suis
infection (FF 1—2). Lapointe used this autogenous vaccine to vaccinate a pig
“herd where clinical signs associated with infection with S. suis type 1/2 had
been observed in piglets of 6 to 8 [weeks] of age” (FF 1).
Lapointe further discloses the identification of six different strains,
e.g., biotypes, of S. susi type 1/2 “in the same herd and other herds
belonging to the same owner” and the comparison of differences among
these strains “by randomly amplified polymorphic DNA (RAPD) with
primers OPB07, OPB10 and OPB17” (FF 2).
10 Declaration of Patrick G. Halbur, signed July 3, 2013.
11 We recognize Appellants also submitted the Declarations of Thomson,
Christopher-Hennings, and Nelson (see e.g., App. Br. 9). We find, however,
that paragraphs 3—10 of the Declaration of Dr. John U. Thomson, DVM,
signed July 9, 2013; paragraphs 2—9 of Declaration of Jane Christopher-
Hennings, signed July 9, 2013, and paragraphs 2—9 of the Declaration of
Eric A. Nelson, signed July 9, 2013 are identical to Halbur Dec. ^fl[ 2—9.
Therefore, we refer to this set of Declarations as Halbur Dec.
10
Appeal 2016-007950
Application 13/277,076
Thus, Lapointe discloses a method of obtaining a biological sample
from at least one first animal, which was exposed to a microorganism that is
subject to shift or drift, determining the biotype of the microorganism in
biological samples by comparing a NOI of the organism in the sample to a
known NOI, preparing an autogenous vaccine from this microorganism, and
vaccinating second animals with the autogenous vaccine (FF 1—2; cf. App.
Br. App’x I claims 1(a) and 35(b)).
Lapointe differs from Appellants’ claims 1 and 35 in that Lapointe
discloses a method of producing an autogenous vaccine that is based on a
sonicated, or killed, microorganism instead of a vaccine based on a RNA
particle that expresses a NOI from the microorganism of interest.
Davis and Erdman, however, disclose an alternative to Lapointe’s
method of vaccine preparation. Specifically, instead of developing vaccines
based on killed versions of a whole microorganism, Davis and Erdman
developed RNA particle based subunit vaccines (i.e., vaccines based on
RNA particles that express one or more NOI(s) of the microorganism of
interest instead of the whole microorganism) that, when expressed in an
animal, produce a protective response to the microorganism of interest (FF
8—12). In addition, Davis and Erdman disclose that the RNA particles are
derived from the VEE alphavirus and lack the structural protein genes
required for viral packaging and, therefore, helper virus are required to
properly package the viral based vaccine (see FF 9 and 11). Thus, Davis and
Erdman suggest a method of vaccine preparation wherein RNA particles that
contain at least one NOI from a microorganism of interest are produced (see
id.', see also FF 4 (wherein Deng discloses that, at the time of Appellants’
claimed invention, RT-PCR was a standard technique that was known and
11
Appeal 2016-007950
Application 13/277,076
commonly employed by those of ordinary skill in this art); see Spec. 58: 15—
16 (“RT-PCR was used both to confirm diagnosis and produce cDNA of
genes targeted for vaccine production”)). Further, as Liljestrom makes clear,
recombinant virus, such as suggested by the combination of Lapointe, Davis,
and Erdman can be produced overnight (see FF 6; see also FF 5; Ans. 7).
On this record, Erdman is of particular interest because it discloses a
RNA particle comprising PRRSV GP5 and M as the NOIs for use as a swine
vaccine (see FF 11—12). In this regard, Examiner explains that Figure 8 of
Appellants’ disclosure and Erdman’s Figure 1 illustrate identical RNA
particles comprising PRRSV GP5 and M (see FF 12; cf. FF 13; see also
Spec. 56: 3 — 63: 10 (discussing the replicon vector construct illustrated in
Appellants’ Figure 8)). Erdman, however, is silent with respect to the source
of the PRRSV GP5 and M NOIs. Thus, the RNA particle vaccine disclosed
by Erdman, differs from a RNA particle vaccine produced according to
Appellants’ claimed method, only in the source of the PRRSV GP5 and M
NOIs; specifically, whether Erdman’s NOIs were obtained from an
autogenous (i.e. farm specific) or non-autogenous (i.e. generic) source.
Therefore, at the time of Appellants’ claimed invention, a person of
ordinary skill in this art would have understood the combination of Lapointe,
Davis, Erdman, and Deng to suggest that microorganisms that are subject to
antigenic shift and drift can be identified through the use of an amplification
technique using primers, or second NOIs, (see, e.g., FF 2) and that RT-PCR
is a standard technique for performing this type of amplification (see, e.g.,
FF 4). Therefore, when, as disclosed by Erdman, it is known, a priori, that a
particular NOI expresses a protein (e.g., PRRSV-1 GP5 and/or M) that is
useful in producing a protective response to a particular biotype of
12
Appeal 2016-007950
Application 13/277,076
microorganism (e.g., PRRSV-1), a person of ordinary skill in this art would
have found it prima facie obvious to use this first NOI, or a fragment
thereof, to amplify a second NOI (e.g., nucleic acid encoding the GP5 and/or
M proteins) from a different biotype of the same microorganism (e.g.,
PRRSV-2) so that this second NOI may be used in the production of a
vaccine as suggested by the combination of Lapointe, Liljestrom, Davis,
Erdman, and Deng to specifically target a microorganism of interest that has
the specific biotype that is infecting, or posing a risk of infecting, an animal,
or herd of animals, on a farm (e.g., PRRSV-2). Because microorganisms
that are subject to shift or drift exhibit variability in their antigenicity, it
would have been prima facie obvious to a person of ordinary skill in this art
at the time of Appellants’ claimed invention to use an autogenous vaccine,
i.e., a vaccine that is specifically designed to target the specific variant of the
microorganism that is infecting, or posing a risk of infecting, animals, or a
herd of animals, on a specific farm (see generally FF 1—2 (Fapointe’s
disclosure of an autogenous vaccine to target microorganisms that are
subject to shift or drift to treat an animal, or a herd of animals, infected, or at
risk of becoming infected, with a specific biotype of the microorganism that
exists on a specific farm or farms having the same owner)). It is proper to
“take account of the inferences and creative steps that a person of ordinary
skill in the art would employ.” KSR Int’l v. Teleflex Inc., 550 U.S. 398, 418
(2007); see also id. at 421 (“A person of ordinary skill is also a person of
ordinary creativity, not an automaton”).
A person of ordinary skill in this art, at the time of Appellants’
claimed invention would have understood that there would have been no
need to isolate a microorganism of interest from a sample if RT-PCR is used
13
Appeal 2016-007950
Application 13/277,076
to amplify a NOI from the sample and that, because, the RNA particles used
in the method disclosed by the combination of Lapointe, Liljestrom, Davis,
Erdman, and Deng lack the structural gene necessary to become virulent, the
RNA particle based vaccine produced by this method would not comprise
the microorganism targeted, a replicable or living pathogenic
microorganism, or revert to virulence when administered. In this regard, we
note that Chen, an evidentiary document relied upon by Appellants, makes
clear that those of ordinary skill in this art recognized, as early as 2009, that
“subunit vaccines[, such as those produced by the method suggested by the
combination of Lapointe, Liljestrom, Davis, Erdman, and Deng,] made from
alphavirus replicon RNA are free of the possibility of replicating virus, since
no structural genes of the alphavirus are present” (see Chen12 188: second
column, first full paragraph).
In addition, Lapointe discloses the use of a pilot study to evaluate
whether a vaccine will exhibit adverse effects in a species of animal to
which it is intended to be administered (see LL 1). Therefore, in view of
Lapointe’s disclosure of a pilot study, we find that a person of ordinary skill
in this art would have found it prima facie obvious, as a matter of best
practice, to test the RNA particle autogenous vaccine produced by the
method suggested by the combination of Lapointe, Liljestrom, Davis,
Erdman, and Deng to determine if it is capable of reverting to a virulent
virus in the species of animal the vaccine is intended to be administered and
to select the RNA vector that does not revert to virulence in that species.
12 Chen, et al., Vaccine development for protecting swine against influenza
virus, 13 Animal Health Research Reviews 181-195 (2012); see App.
Br. 25.
14
Appeal 2016-007950
Application 13/277,076
Lapointe further suggests the use of a “pilot study ... to determine the
appropriate dosage for [a] vaccine” (FF 1). Thus, Lapointe supports a
conclusion that the determination, by routine experimentation, of an
appropriate dosage for an autogenous influenza vaccine prepared by the
method suggested by Lapointe, Liljestrom, Davis, Erdman, and Deng would
have been prima facie obvious to a person of ordinary skill in this art at the
time of Appellants’ claimed invention. See In re Geisler, 116 F.3d 1465,
1470, (Fed. Cir. 1997) (“‘[I]t is not inventive to discover the optimum or
workable ranges by routine experimentation.’”) (quoting In re Aller, 220
F.2d 454, 456 (CCPA 1955)).
At the time of Appellants’ claimed invention, a person of ordinary
skill in this art would have reasonably expected that after an animal or herd
of animals were administered an effective amount of the autogenous vaccine
produced by the method suggested by the combination of Lapointe,
Liljestrom, Davis, Erdman, and Deng, the specific microorganism targeted
would not be detected in the animal or herd of animals treated, because the
vaccine was administered against a specific target. In this regard, we note
that Lapointe and Erdman both disclose the production of autogenous
vaccines that are safe for administration to a food production animal,
specifically pigs (see FF 1—2 and 11).
Thus, at the time of Appellants’ claimed invention, the combination of
Lapointe, Liljestrom, Davis, Erdman, and Deng would have provided a
person of ordinary skill in this art with reasonable expectation of success in
practicing a method for preparing an autogenous subunit vaccine, i.e.,
vaccines that comprise a RNA particle, based on VEE alpha virus,
containing at least one NOI of a microorganism, amplified out of a
15
Appeal 2016-007950
Application 13/277,076
biological sample taken from a dead or diseased animal at a particular farm,
wherein the vaccine would have been produced overnight, using standard
techniques known to those of ordinary skill in this art, and would have been
expected to be safe for administration to a food production animal, e.g.,
swine (cf. App. Br. App’x I claims 1, 2, 31, 33, 34, and 35(a)-(d), (f), and
(g))-
As Examiner explains,
the molecular cloning of a[] NOI by PCR into an expression
vector is well-known by skilled artisans as a cost-effective
method in generating expression vectors for the production of
immunogenic compositions. Further, all of the methods
described above are well-known by skilled artisans to be
capable of being performed at Biosafety level 2 conditions,
such that standard molecular techniques such as amplification
by PCR and RNA extraction methods are in laboratories
conducive to preventing cross contamination of samples.
(Ans. 9.) In this regard, a person of ordinary skill in this art would have
recognized that these standard techniques involve “well-characterized agents
[] known to [not] consistently cause disease in immunocompetent adult
humans, [] present minimal potential hazard to laboratory personnel and the
environment” or “pose moderate hazards to personnel and the environment”
and are “typically conducted on open bench tops using standard
microbiological practices” consistent with Biosafety Level 1 or Level 2
conditions (cf Richmond,13 an evidentiary document relied upon by
Appellants, 30, 33, and 38 (describing the art recognized requirements for
Biosafety Levels 1—3 at the time of Appellants’ claimed invention)).
Therefore, a person of ordinary skill in this art, at the time of Appellants’
13 Richmond et al., Biosafety in Microbial and Biomedical
Laboratories, 4th ed., 30-59 (1999). See App. Br. 11.
16
Appeal 2016-007950
Application 13/277,076
claimed invention would have recognized that the practice of the method
suggested by the combination of Lapointe, Liljestrom, Davis, Erdman, and
Deng would not have required Biosafety Level 3 conditions, which involves
“work [] performed with indigenous or exotic agents that may cause serious
or potentially lethal disease through the inhalation route of exposure” (see
Richmond 38; c/ App. Br. App’x I claim 9).
We recognize that the method of Appellants’ claim 30 depends from
and further limits the microorganism of Appellants’ claim 1 to swine
influenza virus. Examiner finds that the combination of Lapointe,
Liljestrom, Davis, Erdman, and Deng fails to disclose “swine influenza
virus” (SIV) and relies on Swenson to make up for this deficiency (EE 14—
17). Based on the combination of Lapointe, Liljestrom, Davis, Erdman,
Deng, and Swenson, we find no error in Examiner’s conclusion that it would
have been prima facie obvious to use SIV NOIs, e.g., instead of PRRSV
NOIs, to prepare a biotype specific SIV autogenous RNA particle vaccine
(see Ans. 13—14).
The combination of Lapointe, Liljestrom, Davis, Erdman, and Deng:
Claims 1 and 35:
Appellants’ claims 1 and 35 are reproduced above.
For the foregoing reasons, we find no error in Examiner’s conclusion
that, at the time of Appellants’ claimed invention, the combination of
Lapointe, Liljestrom, Davis, Erdman, and Deng make obvious Appellants’
claimed invention (see Ans. 2—7).
17
Appeal 2016-007950
Application 13/277,076
The evidence of record fails to support Appellants’ contention that a
person of ordinary skill in this art would not have combined Lapointe,
Liljestrom, Davis, Erdman, and Deng, as set forth by Examiner, because the
“traditional whole organism autogenous vaccine” described by Lapointe is
different from Erdman’s “recombinant molecule vaccines,” which fails to
account for the contribution of the combination of Liljestrom, Davis,
Erdman, and Deng to Lapointe’s disclosure as discussed above (App. Br. 7—
8).
We are also not persuaded by Appellants’ contentions regarding
“subunit” vaccines (App. Br. 8—9). As discussed above, effective subunit
vaccines were known in the art prior to Appellants’ claimed invention. The
vaccine produced by Appellants’ claimed method is an autogenous “subunit”
vaccine. As discussed above, the combination of Lapointe, Liljestrom,
Davis, Erdman, and Deng makes obvious a method of producing an
autogenous subunit biotype specific vaccine, as required by Appellants’
claimed invention. “The combination of familiar elements according to
known methods is likely to be obvious when[, as here,] it does no more than
yield predictable results.” KSR, 550 U.S. at 416.
Lor the foregoing reasons, we are not persuaded by Appellants’
contention that their claimed “invention is a significant advance in the field
of autogenous vaccines,” because it utilizes recombinant technology as is
disclosed by the combination of Liljestrom, Davis, Erdman, and Deng
instead of “the time consuming and burdensome process of. . . producing a
whole killed vaccine” as disclosed by Lapointe (see App. Br. 8).
As discussed above, the evidence on this record supports a conclusion
that methods of making and using RNA particle based vaccines were known
18
Appeal 2016-007950
Application 13/277,076
in the art prior to Appellants’ earliest effective filing date. This evidence, as
discussed above, further directs a person of ordinary skill in the art to
autogenous RNA particle based vaccines. Therefore, we are not persuaded
by Appellants’ contentions that “experts state that prior to October 27, 2010,
persons skilled in the art of producing animal vaccines understood that
autogenous, farm specific vaccines are whole microorganisms,” such as
those disclosed by Lapointe (App. Br. 9). For the foregoing reasons, we are
not persuaded by Appellants’ contention that “third party experts ... all
agree that the [Appellants’] vaccine production process represents a
fundamental shift from the way animal vaccines were produced and
delivered, and that, [t]he use of recombinant processes in autogenous
vaccines is completely unknown” (id. (citing Halbur Dec. ]ff[ 4—5)).
For the reasons set forth above, we are not persuaded by Appellants’
contention that a person of ordinary skill in this art would not have found it
prima facie obvious to determine, through routine experimentation, the
appropriate dosage for an autogenous vaccine, within the scope of
Appellants’ claimed invention, which is produced by the method suggested
by the combination of Lapointe, Liljestrom, Davis, Erdman, and Deng (see
App. Br. 9). Notwithstanding Appellants’ contention to the contrary,
Ludemann14 does not state that Appellants’ autogenous vaccine does not
work (see Ludemann; cf. App. Br. 16 (“Scientific opinion from the USDA
CVB that the process as claimed would not work:”); see also id. at 13).
Instead, Ludemann simply implies that insufficient information was
provided “as to the appropriate dosage required to induce adequate
protection for each isolate” (see Ludemann). In addition, we are not
14 Ludemann’s April 18, 2006 letter to Dr. D. L. Hank Harris.
19
Appeal 2016-007950
Application 13/277,076
persuaded by Appellants’ contention that as “reflected in [Ludemann], [] it
was believed that autogenous vaccine cannot be produced through
recombinant means and the process and vaccine is new and surprising”
(App. Br. 16). Therefore, we are not persuaded by Appellants’ contentions
regarding Ludemann (see e.g., App. Br. 8—9). In addition, we do not find,
and Appellants fail to identity a specific statement in any of First Veterinary
Services Memorandum (“This guideline provides information and
recommendations about the submission of documents in pursuit of licensure
for biotechnology-derived veterinary biological products”),15 Second
Veterinary Services Memorandum,16 2010 USDA Letter,17 or 2012 USDA
Letter18 that teaches away from the method suggested by the combination of
Lapointe, Liljestrom, Davis, Erdman, and Deng or otherwise suggests that
such a method would not produce an effective autogenous vaccine (see
generally App. Br. 19—20).
For the foregoing reasons, we are not persuaded by Appellants’
contention that the evidence on this record establishes “that a person of skill
in th[is] art would not have made the present combination, and would not
have had a reasonable expectation of success” (App. Br. 10). “For
obviousness under § 103, all that is required is a reasonable expectation of
success.” In re O’Farrell, 853 F.2d 894, 904 (Fed. Cir. 1988).
Notwithstanding Appellants’ contention to the contrary, for the reasons set
forth above, the combination of Lapointe, Liljestrom, Davis, Erdman, and
Deng provides such a reasonable expectation of success.
15 Veterinary Services Memorandum No. 800.205 (May 28, 2003).
16 Veterinary Services Memorandum No. 800.213 (date unknown).
17 USDA Letter to Dr. Kurt I. Kamrud (September 14, 2010).
18 USDA Letter to Ms. Jodi French (August 27, 2012).
20
Appeal 2016-007950
Application 13/277,076
For the foregoing reasons, we are not persuaded by Appellants’
contentions that “[t]he references do not show or suggest that one can
produce a vaccine using the claimed process where the replicon particle is
proven to not be capable of reverting to virulence,” “produced in less than
three months from the time of obtaining the second NOI,” and “safe for
vaccination of a food production animal” (App. Br. 11; see also id. at 19-20;
(citing Third Harris Dec.19 2^4; First Veterinary Services Memorandum;
2010 USDA Letter; 2012 USDA Letter; and Vander Veen20); see also Reply
Br. 4—5).
For the foregoing reasons, we are not persuaded by Appellants’
contentions regarding claim 1 as “set forth in [section] A.2” of their Brief
(App. Br. 11; see id. at 6—10).
Claim 2\
Appellants’ claim 2 depends from and further limits the method of
Appellants’ claim 1 to require that the “protective molecule is capable of
being produced in one month or less from the time of obtaining [the]
sample” (App. Br. App’x IX 1).
As discussed above, a person of ordinary skill in this art, at the time of
Appellants’ claimed invention, would have reasonably expected that a
vaccine produced by the method suggested by the combination of Lapointe,
Liljestrom, Davis, Erdman, and Deng would have been produced overnight,
or at least within one month or less from the time of obtaining a sample.
19 Declaration of Delbert Linn Harris, signed December 22, 2014.
20 Vander Veen et al., Safety, immunogenicity, and efficacy of an alphavirus
replicon-based swine influenza virus hemagglutinin vaccine, 30 Vaccine
1944—1950 (2012).
21
Appeal 2016-007950
Application 13/277,076
Therefore, we are not persuaded by Appellants’ contentions regarding
the time required to produce a vaccine within the scope of their claimed
invention (see App. Br. 10 (citing Halbur Dec. 17; see also id. at 22). For
the same reasons, we are not persuaded by Appellants’ contention that the
time period set forth in Appellants’ claims “for production of the new
vaccine [is] not obvious” {id. at 10).
For the foregoing reasons, we are not persuaded by Appellants’
contentions regarding claim 2 as “set forth in [section] A.2” of their Brief
{id.; see id. at 6—10).
Claim 9:
Appellants’ claim 9 depends from and further limits the method of
Appellants’ claim 1 to require the use of “conditions no more restrictive than
Biosafety Level 2 and at reduced cost compared to a vaccine produced at
Biosafety Level 3 conditions” (App. Br. App’x IX 2).
We recognize Appellants’ contention that the declaratory evidence on
this record establishes that “a skilled person did not believe it was possible
to use replicon particles in a cost effective manner, as they had to be used at
a Biosafety Level 3 where safety issues require costly physical containment”
(App. Br. 11 (citing Halbur Dec. ^fl[ 7—8; and Richmond); see Reply Br. 4—
5).21 Appellants and Declarants, however, fail to explain why the method
21 We recognize Appellants’ reference to a July 9, 2013 Christianson
Declaration and a July 9, 2013 Thomson Declaration (App. Br. 11). Upon
review of the Administrative Record, this Panel was unable to locate either
Declaration {see also, App. Br. App’x X 1—2 (which fails to identify these
specific Declarations). Therefore, these Declarations were not included in
our deliberations.
22
Appeal 2016-007950
Application 13/277,076
suggested by the combination of Lapointe, Liljestrom, Davis, Erdman, and
Deng, which uses replication deficient vims and well-known, conventional,
and routine bench-top techniques, would have required the use of Biosafety
Level 3 conditions as defined by Richmond. Therefore, we are not
persuaded by Appellants’ contention that Examiner’s conclusion lacks an
evidentiary basis for support on this record (see App. Br. 11—12).
Claim 31\
Appellants’ claim 31 depends from and further limits the method of
Appellants’ claim 1 to require that the “microorganism is porcine
reproductive [and] respiratory [syndrome] vims (PRRSV)” (App. Br. App’x
1X3).
As discussed above, the combination of Lapointe, Liljestrom, Davis,
Erdman, and Deng suggests a method of producing an autogenous vaccine
that targets a specific biotype of PRRSV. Therefore, we find no error in
Examiner’s conclusion that the combination of Lapointe, Liljestrom, Davis,
Erdman, and Deng make obvious the subject matter of Appellants’ claim 31
(see Ans. 10-11).
Appellants contend, however, that they presented data, “[a]s discussed
in B.2” of their Brief, that “demonstrates reduced mortality when comparing
the autogenous vaccine as claimed with a traditional autogenous vaccine”
and that this “data strongly supports unexpected superior results from the
invention as claimed in claim 31 and thus it is not obvious” (App. Br. 28; see
also Reply Br. 5—6). Section B.2 of Appellants’ Brief directs attention to
23
Appeal 2016-007950
Application 13/277,076
paragraph 4—7 of the Second Harris Declaration22 and to Sebo23 (see App.
Br. 21—22). We are not persuaded.
Initially, we note that Appellants’ claimed method does not require
the production of a vaccine that results in the reduction in mortality when
compared to a traditional autogenous vaccine. Instead, Appellants’ claimed
method is open to include the production of any number of vaccines which
may or may not reduce mortality when compared to a traditional autogenous
vaccine. Thus, Appellants’ evidence and argument are not commensurate in
scope with their claims.
Further, Sebo discloses “the use of [an Alphavirus RNA Particle (RP)]
vaccine, a 3-gene SIV and 6-gene PRRSV (iFLU-PRRVENT)” to vaccinate
pig litters (Sebo). Thus, the vaccine disclosed by Sebo is not commensurate
in scope with Appellants’ claimed invention.
Sebo discloses that
[i]f [a] rise in mortality rate is related to SIV and PRRSV
infection, the rise in mortality is related to SIV and PRRSV
infections, the sequences of the strains are checked and
compared to those already in the vaccine. If the genetic
homologies differ, the vaccine is modified accordingly to match
the new strains
(Id.). Sebo found that “six of the thirty plus sow farms [receiving the
vaccine] had a rise in mortality over their set benchmarks” (id.). Therefore,
Sebo disclosed that “[g]ene sequences are being prepared and analyzed for
homology to the subtypes in the vaccine to determine if a gene switch out is
required” (id.). Thus, a person of ordinary skill in this art would recognize
22 Declaration of Delbert Linn Harris, signed February 21, 2014.
23 Sebo et al., Monitoring mortality rates for the evaluation of alphavirus
RNA particle vaccines, AASV Annual Meeting (2014).
24
Appeal 2016-007950
Application 13/277,076
from Sebo that vigilance is required to update the constituents of the vaccine
and re-administer the vaccine to account for antigenic variation, e.g., shift or
drift, of the pathogen after an initial vaccine was administered (see Sebo).
Harris declares that “a vaccine [was produced] in which a biological
sample was obtained from [] animals and three differing hemagglutinin­
encoding nucleic acid molecules of interest and six differing PRRSV GP5-
encoding nucleic acid molecules of interest were identified and combined
into a replicon particle vaccine and animals vaccinated,” wherein “the
autogenous nucleic acid molecule vaccine . . . showed lower mortality
compared to the traditional autogenous vaccine” (Second Harris Dec. 1 5).
Initially, we note that Harris’ vaccine is not commensurate in scope with
Appellants’ claimed invention. Further, Harris failed to identity, inter alia,
the source of the “traditional autogenous vaccine” or whether this
“traditional autogenous vaccine” was updated to account for the antigenic
variation of the pathogen treated.
As Examiner explains, in order to establish unexpected results for a
claimed invention, objective evidence of non-obviousness must be
commensurate in scope with the claims which the evidence is offered to
support (see Ans. 18). See, e.g., In re Greenfield, 571 F.2d 1185, 1189
(CCPA 1978). On this record, Appellants failed to establish that Harris’
vaccine comprising “three differing hemagglutinin-encoding nucleic acid
molecules of interest and six differing PRRSV GP5-encoding nucleic acid
molecules of interest” or Sebo’s vaccine comprising a 3-gene SIV and 6-
gene PRRSV (iFLU-PRRVENT) are commensurate in scope with the genus
of vaccines produced by the method of Appellants’ claim 31. In this regard,
we note again that Sebo makes clear that one must be vigilant to ensure that
25
Appeal 2016-007950
Application 13/277,076
the vaccine administered is to the biotype of microorganism currently
infecting, or posing a risk of infecting the animals on a specific farm (see
Sebo).
Accordingly, we are not persuaded by Appellants’ contentions
regarding unexpected results (see App. Br. 28; see also id. at 21—22).
Claim 33:
Appellants’ claim 33 depends from and further limits the method of
Appellants’ claim 1 to require that the “microorganism is selected from[,
inter alia,] porcine reproductive respiratory syndrome virus” (App. Br.
App’x IX 3). As discussed above, the combination of Lapointe, Liljestrom,
Davis, Erdman, and Deng makes obvious a method of producing an
autogenous PRRSV biotype specific vaccine.
For the reasons set forth above, we are not persuaded by Appellants’
contention that
[a] person skilled in the art understood that an autogenous
vaccine for such diseases needed to be whole microorganism
vaccine, and that a recombinant autogenous vaccine that uses a
nucleic acid molecule of interest from these diseases is effective
is surprising. The inventors have shown that such vaccines
effectively protect animals from these diseases. For these
additional reasons it is believed the obviousness rejection has
been rebutted.
(App. Br. 27.)
For the foregoing reasons, we are not persuaded by Appellants’
contentions regarding claim 1 as “set forth in [section] A.2” of their Brief
(App. Br. 12; see id. at 6—10).
26
Appeal 2016-007950
Application 13/277,076
Claim 34:
Appellants’ claim 34 depends from and further limits the method of
Appellants’ claim 1 to require that the
vaccine when administered to a plurality of animals in the same
herd as [the] first animal, morbidity or mortality or both of [the]
plurality of animals in the same herd is less than morbidity or
mortality[] of a herd of animals from [the] same species
following administration] of an autogenous vaccine of [the]
microorganism and/or [the] microorganism is not detected in
[the] plurality of animals.
(App. Br. App’x IX 3 (emphasis added)). According to Appellants a
reduction in morbidity or mortality or both of animals in the
same herd is shown to be possible with the present invention,
and is surprising and unexpected. Claim 34 recites that the
vaccine, when administered to a plurality of animals in the
same herd as the first animal, and morbidity or mortality or
both is less than in a herd of the same species following
administration of the traditional autogenous vaccine. The claim
thus recites surprising and unexpected results and is not
obvious.
(App. Br. 27 (citing id. § B.2); see id. at 12.) We are not persuaded.
Notwithstanding Appellants’ contention to the contrary, Appellants’
claim 34 is not limited to the production of a vaccine that, when
administered to a plurality of animals in the same herd as the first animal,
morbidity or mortality or both is less than in a herd of the same species
following administration of a traditional autogenous vaccine (see App. Br.
27; cf. App. Br. App’x IX 3 (requiring alternatively that the microorganism
targeted is not detected in the plurality of animals after administration of the
vaccine). Thus, Appellants’ contention is not commensurate in scope with
the claimed invention.
27
Appeal 2016-007950
Application 13/277,076
For the foregoing reasons, we are not persuaded by Appellants’
contentions regarding claim 34 as “set forth in [section] A.2” of their Brief
(App. Br. 12; see id. at 6—10).
Claim 36:
Appellants’ claim 36 depends from and further limits the method of
Appellants’ claim 36 to “compris[e] selecting TC-83 RNA vector for use as
[the] RNA vector that does not revert to virulence” (App. Br. App’x IX 4).
Examiner finds that the combination of Lapointe, Liljestrom, Erdman,
and Deng fails to disclose the TC-83 RNA vector required by Appellants’
claim 36 and relies on Davis to make up for this deficiency (Ans. 11).
According to Examiner, Davis discloses “replicons . . . derived from TC-83
VEE” (id. (citing Davis 209: first column, first paragraph)). Although Davis
discloses “[r]eplicon particles based on Venezuelan equine encephalitis virus
(VEE),” we do not find a specific disclosure of TC-83 VEE in Davis. In this
regard, we note that Appellants disclose that more than one VEE vector is
known in the art, specifically V3526 and TC-83 (see Spec. 48). Examiner
failed to establish a reason as to why a person of ordinary skill in this art at
the time of Appellants’ claimed invention would have selected th especitic
TC-83 RNA vector for use in Appellants’ claimed invention.
Thus, Examiner failed to establish an evidentiary basis to support a
conclusion of obviousness with respect to Appellants’ claim 36 (see App.
Br. 11 (he combination of Lapointe, Liljestrom, Davis, Erdman, and Deng
“do[es] not show or suggest that. . . TC-83 may be selected as [the] vector”
for use in Appellants’ claimed method).
28
Appeal 2016-007950
Application 13/277,076
The combination of Lapointe, Liljestrom, Davis, Erdman, Deng, and
Swenson:
Claim 30:
Appellants’ claim 30 depends from and further limits the method of
Appellants’ claim 1 to require that the microorganism is swine influenza
virus (App. Br. App’x IX 3).
For the reasons set forth above, we are not persuaded by Appellants’
contention that Swenson contemplates “traditional autogenous vaccines,”
which fails to account for the combined disclosures of Lapointe, Liljestrom,
Davis, Erdman, and Deng (see App. Br. 12).
We are not persuaded by Appellants’ contention that “the lack of
cross-protection when a microorganism is subject to [] shift and drift, along
with knowledge of whole microorganism vaccines since 1999 and earlier has
not resulted until now in combining autogenous and recombinant processes
as [Appellants’] claim[]” (id.). Notwithstanding Appellants’ contention to
the contrary, the RNA particle vaccines disclosed by both Davis and Erdman
open the door to combining autogenous and recombinant processes, such as
those disclosed by the combination of Lapointe, Liljestrom, Davis, Erdman,
Deng, and Swenson, in the production of an autogenous vaccine, such as that
recited in Appellants’ claimed invention (see FF 1—12 and 15).
Further, the combination of Lapointe, Liljestrom, Davis, Erdman,
Deng, and Swenson suggest obtaining a biological sample from a first
animal exposed to a first biotype of a microorganism (e.g., swine influenza
virus H3N2) and the selection of a NOI from this H3N2 swine influenza
virus that was previously known to be capable of producing a protective
response to another biotype of the virus (e.g., swine influenza virus H1N1)
29
Appeal 2016-007950
Application 13/277,076
so that when the autogenous vaccine produced by the method suggested by
the combination of Lapointe, Liljestrom, Davis, Erdman, Deng, and
Swenson is administered to the animal, or herd of animals, on the same farm
as a first animal, a protective response specific to the first biotype of
microorganism (e.g., H3N2 swine influenza virus) is produced in the second
animal, or herd of animals (cf. App. Br. App’x IX 1 (Appellants’ claim 30)).
Therefore, we are not persuaded by Appellants’ contention that Examiner’s
conclusion of obviousness is based in hindsight (App. Br. 12; see also App.
Br. 25).
For the reasons set forth above, we are not persuaded by Appellants’
contentions regarding claim 30 as “set forth in [section] A.2” of their Brief
(App. Br. 12—13; see id. at 6—10).
SECONDARY CONSIDERATIONS
Teaching Away.
Appellants contend that those of ordinary skill in this art were “taught
that autogenous vaccines are whole organisms, not recombinant molecule
vaccines” and assert “that a vaccine that targets a pathogen using a farm
specific sequence and not the whole organism and that is effective in
protecting an animal from disease is new and surprising” (App. Br. 13 and
15; see id. at 14—16 (citing Halbur Dec. ]Hf 5—6); see also id. at 16 (citing
Luderman); see generally Reply Br. 2—3). We are not persuaded. As
discussed above, notwithstanding Appellants’ contentions and Declarants’
statements to the contrary, the RNA particle vaccines disclosed by both
Davis and Erdman are recombinant molecule vaccines that were known in
the art prior to the filing date of Appellants’ claimed invention and Lapointe
30
Appeal 2016-007950
Application 13/277,076
directs a person of ordinary skill in this art to utilize a farm specific, or
autogenous, pathogen as the source of NOI for the manufacture of a vaccine
as suggested by the combination of Lapointe, Liljestrom, Davis, Erdman,
and Deng, with or without Swenson (see FF 1—12 and 15).
We are not persuaded by Appellants’ contention that “US statutes
required autogenous vaccines be produced from whole organism. 9 C.F.R.
§ 113.[113]” (App. Br. 16; see generally Reply Br. 2 and 4). Initially, we
note that the Code of Federal Regulations is not a United States Statute.
Nevertheless, although 9 C.F.R § 113.113 may reflect the requirements of
autogenous vaccines at the time that regulation was written, Appellants
failed to establish how this section of Title 9 of the Code of Federal
Regulations would have limited those of ordinary skill in this art from
developing alternative methods of producing an autogenous vaccine or
explained how this regulation compels the Patent and Trademark Office to
find an otherwise obvious invention non-obvious (see App. Br. 19; Reply
Br. 2 and 4). See generally, First Veterinary Services Memorandum (“This
guideline provides information and recommendations about the submission
of documents in pursuit of licensure for biotechnology-derived veterinary
biological products”); see also Second Veterinary Services Memorandum;
2010 USDA Fetter; 2012 USDA Fetter. These memoranda, relied upon by
Appellants, regarding the development of biotechnology-derived veterinary
biological products support a conclusion that those of ordinary skill in this
art were not restricted from developing a biotechnology-derived RNA
particle vaccine as suggested by the combination of Fapointe, Filjestrom,
Davis, Erdman, and Deng, with or without Swenson. Cf. Scott v. Finney, 34
F.3d 1058, 1063 (Fed. Cir. 1994) (“Testing for the full safety and
31
Appeal 2016-007950
Application 13/277,076
effectiveness of a prosthetic device is more properly left to the Food and
Drug Administration (FDA). Title 35 [of the United States Code] does not
demand that such human testing occur within the confines of Patent and
Trademark Office (PTO) proceedings”).
As discussed above, the RNA particle vaccines disclosed by both
Davis and Erdman open the door to combining autogenous and recombinant
processes, such as those disclosed by the combination of Lapointe,
Liljestrom, Davis, Erdman, and Deng, with or without Swenson, in the
production of an autogenous vaccine, such as that recited in Appellants’
claimed invention (see FF 1—12 and 15). Appellants fail to identify an
evidentiary basis on this record to support a conclusion that the mode of
operation of the RNA particle vaccines made obvious by the combination of
Lapointe, Liljestrom, Davis, Erdman, and Deng, with or without Swenson,
differs from the mode of operation of an autogenous vaccine produced by
the process of Appellants’ claimed invention. Therefore, we are not
persuaded by Appellants’ contention that “[t]he mode of action of
autogenous vaccines is, and to this day remains, unknown” and “[sjkilled
person[s] were convinced they had to be whole microorganism vaccines”
(App. Br. 17 (citing Holtfreter24); see Reply Br. 3).
Davis and Erdman provide a reasonable expectation of success in
using autogenous RNA particle vaccines produced by a method made
obvious by the combination of Lapointe, Liljestrom, Davis, Erdman, and
24 Holtfreter et al., Antibody responses in furunculosis patients vaccinated
with autologous formalin-killed Staphylococcus aureus, 30 Eur. J. Clin.
Microbiol Infect Dis, 707-717 (2011). See App. Br. 17 (As Appellants
explain Holtfreter uses the terms “‘autologous’ or ‘autovaccination’” as a
synonym for the term “autogenous”).
32
Appeal 2016-007950
Application 13/277,076
Deng, with or without Swenson (FF 1—12 and 15). Therefore, we are not
persuaded by Appellants’ contentions to the contrary (App. Br. 17—18 (citing
Thomson Dec.2511—13)).26 For the reasons set forth above, wherein the
difference between an autogenous and non-autogenous vaccine is the source
of the NOI, we are not persuaded by Thomson’s statement that “[e]ven if the
molecule was one that had been used in a recombinant vaccine to produce
protection, it would not have been believed sufficient for an autogenous
vaccine” (Thomson Dec. 112).
For the foregoing reasons, we are not persuaded by Appellants’
contention that “[ajmong the technical and scientific hurdles they knew were
faced in 2010 is that autogenous vaccines are different from other vaccines”
or that “it was understood in 2010 that one region of a microorganism
genome, one molecule alone, would not be sufficient to provide cross
protection where the microorganism is subject to shift and drift... and the
molecule is not highly conserved” (App. Br. 18; see id. at 18—19 (citing
Thomson Dec. 12—14 and Ludemann)).
Appellants fail to identify a limitation in their claimed invention that
requires the use of a “molecule that is not highly conserved” or, specifically,
“the hemagglutinin protein of influenza” (see App. Br. App’x IX 1—5; cf.
25 Declaration of Dr. John U. Thomson, DVM, signed December 22, 2014.
26 We recognize Appellants also submitted the Declarations of Christianson,
Nelson, Halbur, and Christopher-Hennings (see generally App. Br. 17—18).
We find, however, that paragraphs 2—14 of each of the December 19, 2014
Declaration of Dr. Bill Christianson, December 21, 2014 Declaration of Eric
A. Nelson, December 19, 2014 Declaration of Patrick G. Halbur, and
December 22, 2014 Declaration of Jane Christopher-Hennings are identical
to Thomson Dec. 2—14. Therefore, we refer to this set of Declarations as
Thomson Dec.
33
Appeal 2016-007950
Application 13/277,076
App. Br. 17—19). Further, even if Appellants’ claimed invention were
directed to an autogenous vaccine comprising the influenza hemagglutinin
protein and, as Appellants contend, “the hemagglutinin protein of influenza”
is not highly conserved, we are not persuaded by Appellants’ contentions.
For the reasons discussed above, a person of ordinary skill in this art,
at the time of Appellants’ claimed invention, would have expected that
targeting the specific hemagglutinin protein presenting on a specific farm
(i.e. autogenous) would be more effective than targeting a hemagglutinin
from a non-autogenous virus. Van Reeth,27 an evidentiary document relied
upon by Appellants, supports this conclusion. Specifically, Van Reeth,
supports a conclusion that those of ordinary skill in this art at the time of
Appellants’ claimed invention recognized that there are “antigenic
differences between the [hemagglutinin proteins] in HINI, H3N2 and H1N2
viruses” and “it is not certain that [non-autogenous] commercial vaccines
will protect against the H1N2 virus” (Van Reeth 1380: second column, first
full paragraph). Consistent with the foregoing, Van Reeth established that
pigs that are immune to HINI and H3N2 infection lacked HI antibodies
against influenza H1N2 (Van Reeth 1380: first column, first full paragraph).
Thus, Van Reeth supports a conclusion that the combination of Lapointe,
Liljestrom, Davis, Erdman, and Deng, with or without Swenson makes
obvious a method of making an autogenous RNA particle vaccine based on a
NOI from the specific biotype of microorganism infecting an animal or
posing a risk of infecting animals on a specific farm.
27 Van Reeth et al., Protection against a European H1N2 swine influenza
virus in pigs previously infected with H1N1 and/or H3N2 subtypes, 21
Vaccine 1375-1381 (2003).
34
Appeal 2016-007950
Application 13/277,076
Therefore, we are not persuaded by Appellants’ contention that
“[w]here a molecule is not highly conserved, such as the hemagglutinin
protein of influenza, a recombinant vaccine was not expected to have the
[alleged] improved results of the present vaccine” (App. Br. 18; see also id.
at 20 (citing Thomson Dec. (“a person of skill in the art would not have
expected an autogenous vaccine could be based on a molecule of the
microorganism rather than the whole organism”))). To be complete, we
recognize that although Appellants’ contention may establish some degree of
uncertainty with respect to a generic non-autogenous commercial vaccine;
the evidence of record fails to support Appellants’ contention as it relates to
an autogenous recombinant vaccine as is suggested by the combination of
Lapointe, Liljestrom, Davis, Erdman, and Deng, with or without Swenson.
Thus, notwithstanding Appellants’ contentions to the contrary, for the
reasons set forth above, Appellants’ reliance on Van Reeth supports the
expectations of a person of ordinary skill in this art with respect to a NOI
from an autogenous source rather than a non-autogenous source.
Unexpected Results'.
Appellants contend that they provided evidence
showing] that the vaccines here produced have the unexpected
and superior results of being capable of eliminating the
microorganism, reducing mortality and/or morbidity and further
reducing morbidity or mortality to a higher degree compared to
results when using a traditional autogenous vaccine; are
produced more quickly than prior autogenous vaccines; and
shown to be produced by a process where the RNA vector does
not revert to virulence and can be safely used in food animals.
(App. Br. 13; see id. at 20-21 (citing Halbur Dec. 1 5); see also Reply Br. 5—
6.) In support of Appellants’ contention, Appellants direct attention to
35
Appeal 2016-007950
Application 13/277,076
paragraph 3 of the Second Harris Dec., Christianson Dec.28 and Thompson29,
which discuss the sequential elimination of two Swine Influenza Virus
subtypes from the same sow herd using a swine influenza autogenous
vaccine {id. at 21). In this regard, Christianson declares that “[a] person
skilled in the art would expect a vaccine would decrease disease, but when a
vaccine eliminates the disease, this is unexpected” (Christianson Dec. 1 5
(emphasis added)). We are not persuaded.
As discussed above, in order to establish unexpected results for a
claimed invention, objective evidence of non-obviousness must be
commensurate in scope with the claims which the evidence is offered to
support (see Ans. 18). See, e.g., Greenfield, 571 F.2d at (CCPA 1978). As
the evidence of record suggests, it would have been unexpected that any
autogenous vaccine encompassed by the genus of vaccines set forth in
Appellants’ claimed method would eliminate disease (see Christianson Dec.
1 5). Appellants fail to identify, and we do not find, a claim presented for
review in this Appeal that is limited to a method of producing an autogenous
swine influenza virus vaccine generally, the specific swine influenza virus
vaccine discussed in Second Harris Dec., Christianson Dec. and Thompson,
or a method of producing this specific swine influenza virus vaccine.
Simply stated, the genus of vaccines encompassed by Appellants’ claimed
invention is not limited to the subject matter that the evidence, relied upon
by Appellants, asserts to be unexpected. See, e.g., Greenfield, 571 F.2d at
(CCPA 1978).
28 Declaration of Dr. Bill Christianson, signed February 4, 2014.
29 Thompson et al., Elimination of two consecutive swine influenza subtypes
in a large breed to wean heard, Proc. AASV (2014) {see App. Br. App’x X).
36
Appeal 2016-007950
Application 13/277,076
For the foregoing reasons, we are not persuaded by Appellants’
contentions relating to the First Harris Declaration (First Harris Dec.),30
which, relate to a specific swine influenza virus vaccine that, for the reasons
discussed above, are not commensurate in scope with Appellants’ claimed
invention (see App. Br. 21—22; First Harris Dec.).
As discussed above, Liljestrom establishes that viral constructs
comprising a nucleic acid molecule of interest “can be produced by a single
(overnight) transfection experiment” (Ans. 7; FF 6). Therefore,
notwithstanding Appellants’ contention and Declarants’ statements, the
weight of the evidence on this record supports a conclusion that it would
have been prima facie obvious to produce an autogenous vaccine, within the
scope of Appellants’ claimed invention, “in less than three months, or one
month or less from the time of obtaining the sample from the first animal;
and from less than three months, two months or less, and one month or less
from the time of obtaining the nucleic acid molecule of interest” (App Br. 22
(citing Halbur Dec. 17)31). See Richardson-Vicks Inc. v. Upjohn Co., 122
F.3d 1476, 1483 (Fed. Cir. 1997) (“Evidence of secondary considerations,
including evidence of unexpected results and commercial success, are but a
part of the ‘totality of the evidence’ that is used to reach the ultimate
conclusion of obviousness”).
30 Declaration of Dr. Delbert Linn Harris, signed July 22, 2013.
31 We recognize Appellants’ citation to a July 9, 2013 Christianson
Declaration (App. Br. 22). However, as discussed above, we are unable to
locate this Declaration in the Administrative Record (see App. Br. App’x X).
37
Appeal 2016-007950
Application 13/277,076
Commercial Success and Long-Felt But Unmet Need:
Appellants contend that “demand for the vaccine produced by the
present method vastly outstripped [] prior vaccines” (App. Br. 13).
Appellants further contend that “[sjince introducing [their] invention into the
marketplace, a small and previously unknown company, Harrsivaccines,
Inc., [‘the Assignee of record for this [Application’ and Real Party in
Interest,] has demonstrated a remarkable response from animal producers
seeking an improved means to protect their animals” (App. Br. 22; see also
id. at 22—24 (citing First Harris Dec. H 8—10; Second Harris Dec. H 9-10;
and Third Harris Dec. 1 8); id. at 1 (“The real party in interest for this
application is the Harrisvaccines, Inc., the Assignee of record for this
application”)).
Harris provides sales data associated with Harrisvaccines’ sale of:
(1) “autogenous RNA particle vaccines . . . based on nucleic acid molecules
of intrest of GP5 nucleic acid molecule for PRRSV, HA nucleic acid
molecule for SIV, combination of PRRSV/SIV, and VP7 nucleic acid
molecule for Rotavirus” and (2) “a non-autogenous subunit vaccine for
Swine Influenza Virus (SIV) and Porcine Respiratory Reproductive
Syndrome Virus (PRRSV) and a combination of PRRSV/SIV” (Second
Harris Declaration H 9-10 (emphasis added); see also First Harris Dec.
11 8—10). Harris declares that
The same company, Harrisvaccines, sold the vaccines, and the
price of the vaccines, sales budget, advertising sales personnel,
marketing and other sales practices did not change. The
company was not a market leader in the area of animal
vaccines, and at the time was a small vaccine company with 26
employees in 2011 and fewer employees, 22 total, in 2012.
There was only one salesperson in 2011 and 2012. I am
38
Appeal 2016-007950
Application 13/277,076
unaware of any factor that would have influenced the sales
increase between the vaccines other than the efficacy and
success of the invention vaccine.
(Third Harris Dec. 1 8; see also App. Br. 23—24 (“Applicants] point[] out
that the comparison of sales is of doses sold comparing a non-autogenous
recombinant subunit vaccine to the autogenous recombinant vaccine
produced by the claimed method, where the same recombinant molecule is
used”)). We are not persuaded.
When a patentee offers objective evidence of nonobviousness,
there must be a sufficient relationship between that evidence
and the patented invention. . . . “The term ‘nexus’ is used, in
this context, to designate a legally and factually sufficient
connection between the proven success and the patented
invention, such that the objective evidence should be
considered in the determination of nonobviousness. The burden
of proof as to this connection or nexus resides with the
patentee.”
In re Paulsen, 30 F.3d 1475, 1482 (Fee. Cir. 1994) (citations omitted).
Appellants’ evidence of commercial success is based on a comparison
of an autogenous vaccine to a non-autogenous vaccine (see First Harris Dec.
11 8—10; Second Harris Declaration H 9-10; Third Harris Dec. 1 8 ; see also
App. Br. 23—24). We recognize Appellants’ contention and Harris’
declaration that the autogenous and non-autogenous vaccines compared on
this record comprised the same recombinant molecule (Third Harris Dec.
1 8; see also App. Br. 23—24). The evidence on this record, however, makes
clear that there are differences between autogenous and non-autogenous
vaccines, even those prepared with the same recombinant molecule (see
Thomson Dec. 112 (“Even if the molecule was one that had been used in a
recombinant vaccine to produce protection, it would not have been believed
sufficient for an autogenous vaccine”).
39
Appeal 2016-007950
Application 13/277,076
Appellants’ evidence of commercial success fails to account for the
fact that non-autogenous vaccines are different from autogenous vaccines,
because they are not directed to the specific virus currently presenting itself
on a specific farm. Therefore, we are not persuaded by Appellants’
contention that “there is a clear nexus: when a vaccine using the same
molecule was produced, but using the claimed method versus prior methods,
the demand vastly outstripped the prior vaccine” (cf. Reply Br. 7—8). See
generally, In re Huang, 100 F.3d 135, 140 (Fed. Cir. 1996) (“Although
Huang’s affidavit certainly indicates that many units have been sold, it
provides no indication of whether this represents a substantial quantity in
this market.”); In re Baxter Travenol Labs., 952 F.2d 388, 392 (Fed. Cir.
1991) (“[Information solely on numbers of units sold is insufficient to
establish commercial success.”); In re Heldt, 433 F.2d 808, 812 (CCPA
1970) (“affidavits] dealing] with alleged commercial success .. . can only
be given effect when it is positively clear from the facts presented therein
that the commercial success asserted was the direct result of the unique
characteristics of the claimed invention and not due to other causes.”).
Moreover, we note that Appellants failed to establish that their autogenous
vaccine exhibited commercial success relative to autogenous vaccines in
commerce at the time of Appellants’ claimed invention (see generally
Halbur Dec. 1 5 (“Persons skilled in the art of producing animal vaccines
prior to the filing date of the priority document of the above application
October 27, 2010 understood that autogenous (farm specific) vaccines are
whole microorganism vaccines produced by culturing the organism from
dead or diseased animals”); cf. Reply Br. 6—8). See In re DBC, 545 F.3d
1373, 1384 (Fed. Cir. 2008) (Evidence of commercial success “must offer
40
Appeal 2016-007950
Application 13/277,076
proof ‘that the sales were a direct result of the unique characteristics of the
claimed invention—as opposed to other economic and commercial factors
unrelated to the quality of the patented subject matter.’”).
Further, Appellants failed to establish that the evidence of commercial
success relating to specific RNA particle construct vaccines is
commensurate in scope with the genus of vaccines encompassed by the
method of producing an autogenous vaccine set forth in Appellants’ claimed
invention (see generally Ans. 10; cf. Reply Br. 6—8). See In re Affinity Labs
of Texas, LLC, 856 F.3d 883 (Fed. Cir. 2017) (“Evidence of commercial
success is only relevant to the obviousness inquiry ‘if there is a nexus
between the claimed invention and the commercial success.’ . . . There is no
nexus unless the evidence presented is “reasonably commensurate with the
scope of the claims.”) (citations omitted).
For the reasons discussed above, in view of the combination of
Lapointe, Liljestrom, Davis, Erdman, and Deng, with or without Swenson,
we are not persuaded by Appellants’ contention that Chen’s “review of
vaccine development” “reflects] the acceptance of [Appellants’] process as
a surprising and revolutionary breakthrough” (App. Br. 24; see id. 25; see
also Reply Br. 8). In addition, Appellants failed to establish that Chen’s
discussion of vaccine development for protecting swine against influenza
virus is commensurate in scope with Appellants’ claimed invention.
We are not persuaded by Appellants’ contentions regarding “a long-
felt need” (App. Br. 25). As discussed above, notwithstanding Appellants’
contention to the contrary, the VRP vaccines disclosed by both Davis and
Erdman provided the key that opened the door to combining autogenous and
recombinant processes, such as those disclosed by the combination of
41
Appeal 2016-007950
Application 13/277,076
Lapointe, Filjestrom, Davis, Erdman, and Deng, with or without Swenson,
in the production of an autogenous vaccine, such as that recited in
Appellants’ claimed invention (see FF 1—12 and 15). See Newell Companies
v. Kenney Mfg. Co., 864 F.2d 757, 768, 9 USPQ2d 1417, 1426 (Fed.
Cir.1988) (“[OJnce another supplied the key element, there was no long-felt
need or, indeed, a problem to be solved”.)
Therefore, for the reasons set forth above, we are not persuaded by
Appellants’ contention that Appellants’ rebuttal “evidence of teaching away,
unexpected and superior results, commercial success and long-felt but unmet
need” outweigh Examiner’s prima facie case of obvious with respect to
Appellants’ claims 1, 2, 30, 31, and 33—35 (see App. Br. 25 (emphasis
removed); see also id. at 25—28).
CONCFUSION OF FAW
The preponderance of evidence relied upon by Examiner supports a
conclusion of obviousness with respect to claims 1, 2, 9, 31, and 33—35.
The rejection of claims 1, 2, 9, 31, and 33—35 under 35 U.S.C.
§ 103(a) as unpatentable over the combination of Fapointe, Filjestrom,
Davis, Erdman, and Deng is affirmed. Claims 5—8, 10, 20-24, 32, 39, and
40 are not separately argued and fall with claims 1 and 35, respectively.
Claim 37 is not separately argued and falls with claim 9. Claim 38 is not
separately argued and falls with claim 33.
The rejection of claim 30 under 35 U.S.C. § 103(a) as unpatentable
over the combination of Fapointe, Filjestrom, Davis, Erdman, Deng, and
Swenson is affirmed.
The preponderance of evidence relied upon by Examiner fails to
support a conclusion of obviousness with respect to claim 36.
42
Appeal 2016-007950
Application 13/277,076
The rejection of claim 36 under 35 U.S.C. § 103(a) as unpatentable
over the combination of Lapointe, Liljestrom, Davis, Erdman, and Deng is
reversed.
NEW GROUND OF REJECTION
Claim 36 is newly rejected under 35 U.S.C. § 103(a) as unpatentable
over the combination of Lapointe, Liljestrom, Davis, Erdman, Deng, and
Rayner.32
FACTUAL FINDINGS
We incorporate the findings of fact set forth, supra, and make the
following additional findings.
FF 18. Rayner 2005 discloses
TC-83 VEE-derived replicons, alphaviral replicon particles and
immunogenic compositions containing TC-83 alphaviral
replicon particles which direct the expression of at least one
antigen when introduced into a suitable host cell. The TC-83
VEE-derived ARPs described [by Rayner] are improved in that
they are subject to a lower vector-specific immune response
than prior art ARPs.
(Rayner 2005, Abstract; see also id. 19 (Rayner “provides compositions of
infective, replication-defective, highly immunogenic alphavirus replicon
particles based on a particular alphavirus strain, i.e., the TC-83 of VEE, and
methods of preparation thereof’); id. 121—24 (disclosing a method of
preparing TC-83 RNA particles comprising a heterologous nucleic acid); see
generally Ans. 5.)
32 Rayner et al., US 2005/0266550 Al, published Dec. 1, 2005.
43
Appeal 2016-007950
Application 13/277,076
FF 19. Rayner2005 discloses:
[A] method of producing an immune response in a subject,
comprising administering to the subject an effective amount of
an immunogenic composition comprising a population of
infectious, propagation-defective alphavirus particles in a
pharmaceutically-acceptable carrier, wherein the composition
comprises particles comprising a VEE TC-83 replicon RNA
comprising an alphavirus packaging signal, one or more
heterologous RNA sequence(s) encoding an immunogen and
lacking sequences encoding alphavirus structural proteins.
(Rayner 2005 118; see id. 24 and 63—71; see id. 170 (“The compositions
. . . [disclosed by Rayner 2005] can be used prophylactically to prevent
disease or therapeutically to tread disease,” such as “infectious disease
caused by viruses, bacteria, fungi or parasites”).)
FF 20. Rayner 2005 discloses:
An “immunogenic amount” is an amount of the infectious
alphavirus particles which is sufficient to evoke an immune
response in the subject to which the pharmaceutical formulation
comprising the alphavirus particles is administered. An amount
of from about 104 to about 109, especially 106 to 10s, infectious
units, per dose is believed suitable, depending upon the age and
species of the subject being treated.
(Rayner 2005 1 68.)
FF 21. Rayner 2005 discloses that “[standard techniques for cloning, DNA
isolation, amplification and purification, for enzymatic reactions involving
DNA ligase, DNA polymerase, restriction endonucleases and the like, and
various separation techniques are those known and commonly employed by
those skilled in the art” (Rayner 2005 177).
ANALYSIS
As discussed above, the combination of Lapointe, Liljestrom, Davis,
Erdman, and Deng fails to disclose the TC-83 RNA vector required by
44
Appeal 2016-007950
Application 13/277,076
Appellants’ claim 36. Rayner, however, discloses immunogenic
compositions containing the VEE TC-83 alphaviral replicon particles which
direct the expression of at least one antigen when introduced into a suitable
host cell (18—19). Rayner discloses the construction of a vaccine comprising
a population of infectious, propagation-defective alphavirus
particles in a pharmaceutically-acceptable carrier, wherein the
composition comprises particles comprising a VEE TC-83
replicon RNA comprising an alphavirus packaging signal, one
or more heterologous RNA sequence(s) encoding an
immunogen and lacking sequences encoding alphavirus
structural proteins.
(FF 19 (emphasis added)). Thus, a person of ordinary skill in this art would
have understood that the TC-83 RNA particle, or a vaccine based on this
RNA particle, would not revert to virulence because it lacks the structural
proteins required to do so (see id.). In addition, the “TC-83 VEE-derived
[RNA particles] disclosed [by Rayner] are improved in that they are subject
to a lower vector-specific immune response than prior art” RNA particle
vaccine constructs (FF 18).
Therefore, at the time of Appellants’ claimed invention, a person of
ordinary skill in this art would have found it prima facie obvious to use a
TC-83 alphaviral replicon particle as the RNA vector in the method of
producing an autogenous vaccine, which is suggested by the combination of
Lapointe, Liljestrom, Davis, Erdman, and Deng.
In addition, we note that Rayner supports a conclusion that the
methodology suggested by the combination of Lapointe, Liljestrom, Davis,
Erdman, and Deng is well-known, routine, and conventional in this art and
therefore would not have required Biosafety Level 3 conditions (FF 21). In
addition, Rayner supports a conclusion that those of ordinary skill in this art
45
Appeal 2016-007950
Application 13/277,076
would have recognized that effective dosages for the autogenous vaccine
produced by the combination of Lapointe, Liljestrom, Davis, Erdman, Deng,
and Rayner, were known in the art and variations in dosage due to the age
and species of the subject being treated could have been determined by
routine optimization (see FF 20).
For the reasons above, we make a new ground of rejection for claim
36 under 35 U.S.C. § 103(a) over the combination of Fapointe, Filjestrom,
Davis, Erdman, Deng, and Rayner.
TIME PERIOD FOR RESPONSE
Regarding the affirmed rejection(s), 37 C.F.R. § 41.52(a)(1) provides
“Appellant may file a single request for rehearing within two months from
the date of the original decision of the Board.”
In addition to affirming the Examiner’s rejection(s) of one or more
claims, this decision contains a new ground of rejection pursuant to 37
C.F.R. § 41.50(b). 37 C.F.R. § 41.50(b) provides “[a] new ground of
rejection pursuant to this paragraph shall not be considered final for judicial
review.”
37 C.F.R. § 41.50(b) also provides that the Appellant, WITHIN TWO
MONTHS FROM THE DATE OF THE DECISION, must exercise one of
the following two options with respect to the new ground of rejection to
avoid termination of the appeal as to the rejected claims:
(1) Reopen prosecution. Submit an appropriate amendment of
the claims so rejected or new evidence relating to the claims so
rejected, or both, and have the matter reconsidered by the
examiner, in which event the proceeding will be remanded to
the examiner....
46
Appeal 2016-007950
Application 13/277,076
(2) Request rehearing. Request that the proceeding be reheard
under § 41.52 by the Board upon the same record....
Should the Appellant elect to prosecute further before the Examiner
pursuant to 37 C.F.R. § 41.50(b)(1), in order to preserve the right to seek
review under 35 U.S.C. §§ 141 or 145 with respect to the affirmed rejection,
the effective date of the affirmance is deferred until conclusion of the
prosecution before the Examiner unless, as a mere incident to the limited
prosecution, the affirmed rejection is overcome.
If the Appellant elects prosecution before the Examiner and this does
not result in allowance of the application, abandonment or a second appeal,
this case should be returned to the Patent Trial and Appeal Board for final
action on the affirmed rejection, including any timely request for rehearing
thereof.
AFFIRMED-IN-PART; 41.50(b)
47
Notice of References Cited
Application/Control No. Applicant(s)/Patent Under
Reexamination
13/277,076 Delbert Linn Harris, et al.
Examiner Art Unit
1648 Page 1 of 1
U.S. PATENT DOCUMENTS
* Document Number
Country Code-Number-Kind Code
Date
MM-YYYY Name CPC Classification US Classification
A us-
B us-
C US-
D US-
E US-
F US-
G US-
H US-
1 US-
J US-
K US-
L US-
M US-
FOREIGN PATENT DOCUMENTS
* Document Number
Country Code-Number-Kind Code
Date
MM-YYYY Country Name CPC Classification
N
O
P
Q
R
S
T
NON-PATENT DOCUMENTS
* Include as applicable: Author, Title Date, Publisher, Edition or Volume, Pertinent Pages)
U Rayner et al., US 2005/0266550 Al, published Dec. 1, 2005
V
w
X
*A copy of this reference is not being furnished with this Office action. (See MPEP § 707.05(a).)
Dates in MM-YYYY format are publication dates. Classifications may be US or foreign.
U.S. Patent and Trademark Office
PTO-892 (Rev. 01-2001) Notice of References Cited Part of Paper No. 20170303
US 20050266550A1
(19) United States
(12) Patent Application Publication uo) Pub. No.: US 2005/0266550 Al
Rayner et al. (43) Pub. Date: Dec. 1,2005
(54) TC-83-DERIVED ALPHAVIRUS VECTORS,
PARTICLES AND METHODS
(75) Inventors: Jon O. Rayner, Apex, NC (US);
Jonathan F. Smith, Cary, NC (US);
Bolyn Hubby, Chapel Hill, NC (US);
Elizabeth A. Reap, Durham, NC (US)
Correspondence Address:
GREENLEE WINNER AND SULLIVAN P C
4875 PEARL EAST CIRCLE
SUITE 200
BOULDER, CO 80301 (US)
(73) Assignee: Alphavax, Inc., Research Triangle Park,
NC
(21) Appl. No.: 11/132,711
(22) Filed: May 18, 2005
Related U.S. Application Data
(60) Provisional application No. 60/572,212, filed on May
18, 2004.
Publication Classification
(51) Int. Cl.7 ...................... C12P 21/06; A61K 39/12;
C12N 15/00; C12N 15/09;
C12N 15/63; C12N 15/70;
C12N 15/74
(52) U.S. Cl................ 435/320.1; 424/199.1; 424/204.1;
435/69.1
(57) ABSTRACT
The present disclosure provides TC-83 VEE-derived repli-
cons, alphaviral replicon particles and immunogenic com­
positions containing TC-83 alphaviral replicon particles
which direct the expression of at least one antigen when
introduced into a suitable host cell. The TC-83 VEE-derived
ARPs described herein are improved in that they are subject
to a lower vector-specific immune response than prior art
ARPs.
Xbal (11050)
HddIII(10938)
Cial(10933)
.EcoRI(10907)
Hnd 111(10640)
KN(R)
CM(10213)
XAoI(10120)
COLEI ORI
" Not 1(7785)
Sph 1(7663)
Pacl(7602)
26S promoter
Ascl(7575)
£coRV(7565).
Apal(7507)
Miel(7469)
Hind 11(7362)
Hind III (7292)
Hind 11(6903)
A5fiel(6652) .
nsP4
Hind 11(6157)
AfioI(5596)
ASoI(5555)
Hind 11(64)
Hind 11(514)
, Hod 11 (660)• .
nsPI
Hind11(1150)
Hind11(1624)
i^pn I (1957)
Spe I (2086)
Bam HI(2122)
£coRI(2138)
Hind III (2409)
BamHI(2485)
nsP2
Kpn 1(3361) ....
Hind 11(3595)
HndIII(3746)
Hndll(3759)
Hind HI (3768)
HndIII(3974)
Hind III (4162)
Hind11(4321)
Mel(5330)
A2ioI(5494)
11/13/2017, EAST Version: 3.3.1.2
Patent Application Publication Dec. 1, 2005 Sheet 1 of 3 US 2005/0266550 A1
, EAST Version: 3.3.1.211/13/2017
FI
G
. 1
Patent Application Publication Dec. 1,2005 Sheet 2 of 3 US 2005/0266550 At
Silver Stain Western Blots
KDa - KDa GP KDa Capsid
188 188
116
97 -
66 ' 62 . 62
55 ~ 49 P
Gp
■* 4g
36 <
31
38
Capsid
31 ,
38 ism*®1
28
21
FIG. 2
11/13/2017, EAST Version: 3.3.1.2
Patent Application Publication Dec. 1,2005 Sheet 3 of 3 US 2005/0266550 A1
Ate I(11050)
MMIII(10938)
CM (10933)
j5coRI( 10907)
MM III (10640)
KN(R)
CM(10213)
Xtel(10120)
COLEI ORI
Not 1(7785) _
Sph 1(7663)
iMI(7602)
26S promoter
Ascl(7575)
_EcoRV(7565)
Apal(7507)
Mrel(7469)
Hind11(7362)
MM111(7292)
Mind 11(6903)
Nhc\(6652)'
nsP4
MMII(6157)
AMI(5596)
AMI(5555)
MM 11(64)
— MrM 11(514)
Hind11(660)
nsPI
MrM11(1150)
Mind11(1624)
Mpnl(1957)
5pel(2086)
Bam HI(2122)
£coRI(2138)
MrM III (2409)
Bam HI(2485)
nsP2
Mpnl(3361) ..
MrMII(3595)
Mind III (3746)
M/M II (3759)
MM III (3768)
M/MIII(3974)
Mind III (4162)
MrM11(4321)
nsP3
AMI(5330)
AMI(5494)
FIG. 3
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
1
Dec. 1, 2005
TC-83-DERIVED ALPHAVIRUS VECTORS,
PARTICLES AND METHODS
CROSS REFERENCE TO RELATED
APPLICATIONS
[0001] This application claims benefit of U.S. Provisional
Application No. 60/572,212, filed May 18, 2004, which
application is incorporated by reference herein to the extent
there is no inconsistency with the present disclosure.
ACKNOWLEDGMENT OF FEDERAL
RESEARCH SUPPORT
[0002] This invention was made, at least in part, through
funding from the United States government, through grants
from the National Institutes of Health, grant numbers 1U01
AI056438-01 and 5U01 AI 55071-02. °
progeny are prevented from assembly since the replicons do
not encode all of the essential viral packaging (structural)
genes.
[0006] Both the alphaviral genetic background for the
replicon and the alphaviral structural proteins used to pack­
age the replicon have a significant impact on the ultimate
performance of the replicon particles. The VEE virus has
been preferred as a vaccine vector among the alphaviruses
because it is naturally lymphotrophic, which leads to strong
cellular and humoral immune responses at relatively low
immunization doses (Davis, N Let al. (1996)/. Virol. 70(6):
3781-7; MacDonald, G H and Johnston R E, (2000)/. Virol.
74(2): 914-922; Caley I J et al. (1997) /. Virol. 71: 3031-
3038; Hevey M et al. (1998) Virology 251(1): 28-37; Caley
t t ai „i zi noo\ tx j vi ax. y y y j rwwi
Vaccine 19:142-153).
1 '7-0^_0/1 • rwuu,X UOllXW, X VI .,! (2001)
BACKGROUND OF THE INVENTION
[0003] The present invention relates to recombinant DNA
technology, and in particular to introducing foreign nucleic
acid in a eukaryotic cell, and more particularly to compo­
sitions and methods for producing alphavirus replicon par­
ticles useful in immunotherapies and/or gene therapy appli­
cations. In particular, the present invention discloses a
genetic background for the alphavirus replicon particle
system that is based on the Venezuelan Equine Encephalitis
virus (VEE) vaccine strain, TC-83.
[0004] A variety of viruses is included in the alphavirus
genus, which is a member of the Togaviridae family. The
alphaviral genome is a single-stranded, messenger-sense
RNA, modified at the 5'-end with a methylated cap and at the
3'-end with a variable-length poly (A) tract. Structural
subunits containing a single viral protein, capsid, associate
with the RNA genome in an icosahedral nucleocapsid. In the
virion, the nucleocapsid is surrounded by a lipid envelope
covered with a regular array of transmembrane protein
spikes, each of which consists of three heterodimeric com­
plexes of two glycoproteins, El and E2. See Paredes et al.,
(1993) Proc. Natl. Acad. Sci. USA 90:9095-9099. The Sind-
bis and Semliki Forest viruses are considered the prototypi­
cal alphaviruses and have been studied extensively. See
Schlesinger, The Togaviridae and Flaviviridae, Plenum Pub­
lishing Corp., New York (1986). The VEE virus has also
been studied extensively, see, e.g., U.S. Pat. Nos. 5,185,440,
5,505,947, and 5,643,736.
[0005] The use of propagation-defective alphavirus par­
ticles, termed alphaviral replicon particles, has shown great
promise as a viral vector delivery system. Replicons are
constructed to carry one or more heterologous antigens in
place of some or all of the alphavirus structural genes. The
replicons are introduced into alphavims-permissive cells
along with a helper construct(s) that expresses the viral
structural protein(s) not encoded by the replicon or, alter­
natively, the replicon is introduced into a packaging cell
capable of expressing the structural proteins. The replicon is
then packaged, analogous to the packaging of the intact
alphaviral genome, by the expressed structural proteins.
These packaged replicons, or alphaviral replicon particles,
are then inoculated into an animal. The particles enter the
host cell, and the replicons then express the introduced
heterologous coding or other functional sequence(s) at very
high levels from the subgenomic mRNA. Subsequent viral
[0007] Several strains of the Venezuelan Equine Encepha­
litis virus (VEE) are known, and within those strains,
subtypes have been recognized. Virulent VEE strains have
been isolated during mosquito-borne epidemic encephalo­
myelitis in equids in tropical and sub-tropical areas of the
New World. One of the most vimlent epizootic strains, the
Trinidad Donkey (TRD) strain, which is in subtype IA/B,
was passaged serially in tissue culture to create a live,
attenuated strain (Berge et al. (1961) Amer. J. Hyg. 73:209-
218) known as TC-83. This strain elicits VEE-specific
neutralizing antibodies in most humans and equines and has
been used successfully as a vaccine in both species (McKin­
ney et al. (1972) “Inactivated and live VEE vaccines—A
Review, in Venezuelan Encephalitis, pp. 369-376, Sc. Pub.
No. 243 Pan American Health Organization, Washington,
D.C.; Walton T E et al. (1972) Am. /. Epidemiol. 95:247-
254; Pittman P R et al. (1996) Vaccine 14(4): 337-343).
Nonetheless, this vaccine presents several problems in terms
of safety and efficacy. First, it can cause adverse, sometimes
moderately severe reactions in human vaccines. Second, the
TC-83 strain shows residual murine virulence and is lethal
for suckling mice after intracerebral (i.c.) or subcutaneous
(s.c.) inoculation (Ludwig G ct al. (2001) Am. J. Trop. Med.
Hyg. Jan-Feb; 64(l-2):49-55). Third, the TC-83 strain has a
significant percentage of non-responders in humans, i.e.,
individuals who do not show a demonstrable humoral
response after inoculation (Pittman P R et al. (1996) Vaccine
14(4): 337-343). Finally, the TC-83 strain is known to be
especially sensitive to interferon, as compared to the paren­
tal TRD strain or other epizootic strains of VEE (Spotts, D
R et al. (1998) J. Virol. 72:10286-10291). Such enhanced
sensitivity to interferon would lead one to expect that the
heterologous genes in a replicon particle would be expressed
less efficiently in an infected cell and/or that such particles
would be less immunogenic in vivo. All of these detrimental
factors associated with the TC-83 vaccine strain of VEE
have led previous researchers to search for better attenuated
strains to use as either propagation-competent VEE vectors
or in replicon particle systems (e.g. Davis N L et al. (1994)
Arch. Virol. Suppl. 9:99-109; Davis N Let al. (1996)/. Virol.
70(6):3781; Pushko et al. (1997) Ibid.; Pratt W D et al.
(2003) Vaccine 21(25-26): 3854-3862).
[0008] There is a continuing need to optimize the combi­
nation of mutations and alphavirus strain to provide the most
effective alphavirus replicon particle for use in vaccine
and/or gene therapy applications.
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
2
Dec. 1, 2005
SUMMARY OF THE INVENTION
[0009] The present invention provides compositions of
infective, replication-defective, highly immunogenic
alphavirus replicon particles based on a particular alphavirus
strain, i.e., the TC-83 of VEE, and methods of preparation
thereof. As described previously (see, for example, U.S. Pat.
Nos. 5,792,462; 6,156,558; 5,811,407; 6,008,035; 6,583,
121; WO 03/023026; U.S. Publication No. 2003/0119182,
all incorporated herein by reference), functional alphavirus
replicon particles have been made from several different
alphaviruses and chimeras thereof (see, for example, U.S.
Publication No 2003/0148262). These particles are useful in
vaccine and gene therapy applications, and the optimal
characteristics of the alphavirus replicon particles differ in
these applications. For instance, it may be useful to reduce
the expression of proteins from the replicon during gene
therapy applications, and thus techniques have been devel­
oped in the art to reduce such expression (see e.g. U.S. Pat.
Nos. 5,843,723 and 6,451,592). In the case of vaccine
applications, maximizing the expression of the heterologous
RNA from the replicon, minimizing any anti-vector
responses, and targeting the tissues and cells of the immune
system are desirable features. The alphaviruses Venezuelan
Equine Encephalitis (VEE) virus and South African Arbo­
virus No. 86 have proved particularly useful in the vaccine
applications. To improve the safety of these alphavirus
vectors in the rare event that a replication-competent virus is
generated, at least one attenuating mutation has been intro­
duced into the alphaviral genomic fragments. The present
inventors have now discovered that the TC-83 strain of VEE
can be used as the genetic background for an alphavirus
replicon particle system which provides a surprisingly effec­
tive VEE particle preparation for use in immunogenic com­
positions and which has other surprisingly advantageous
properties useful in a vaccine vector system, including the
ability to prepare purified preparations with ease.
[0010] The present inventors have discovered that the
TC-83 strain of VEE is a surprisingly good alphavirus strain
from which to derive a replicon vaccine particle. A complete
sequence of the TC-83 sequence was published (Kinney R
M et al. (1989) Virology 170:19-30; with correction noted in
Kinney R M et al. (1993) J. Virol. 67(3): 1269-1277). The
genome of this live, attenuated vaccine strain carries 12
differences from the virulent, parental strain from which it
was derived. These mutations are: a single nucleotide sub­
stitution (G^A) at nucleotide 3 of the 5' non coding region;
amino acid substitutions at nsP2-16 (Ala—»Asp), nsP3-260
(Ser—»Thr), E2-7 (Lys^Asn), E2-85 (His^Tyr), E2-120
(Thr—»Arg), E2-192 (Val^Asp), E2-296 (Thr^Ile), and
El-161 (Leu—»Ile); 2 silent nucleotide substitutions at
deletion at nucleotide 11,405 in the 3' non-coding region
(UU-»U). Kinney et al. 1993 Ibid, have suggested that the
attenuated phenotype of the live TC-83 strain (i.e. reduced
neurovirulence in mice) is due to the nucleotide 3 mutation
(G to A) and the E2 mutations, particularly the E2-120
mutation. It has been shown that this nucleotide 3 mutation,
when introduced into a wild-type strain of VEE, attenuates
the strain (White L J et al. (2001) J. Virol 75: 3706-3718).
However, the methods used do not exclude contributions
from other mutations, and the existence of the numerous
other nonconservative mutations in the TC-83 genome make
it impossible to predict whether it can serve as an effective
genetic background for the replicon particle system.
[0011] The inventors have now produced a replicon par­
ticle vaccine based on the TC-83 strain, and it has several
surprisingly advantageous characteristics for both vaccine
and gene therapy applications including, but not limited to,
much higher yields as compared to those achieved with
particles based on wild-type VEE or on those carrying other
attenuating mutations; lowered anti-vector responses;
increased purity; excellent immunogenicity that is compa­
rable to other VEE strains carrying only one, two or three
attenuating mutations, and no non-responsiveness, in con­
trast to the noted non-responsiveness of animals to the live
TC-83 strain used as a vaccine.
[0012] Additionally, the inventors have discovered that
packaging an alphavirus replicon in the VEETC83 structural
proteins results in significantly higher yields of replicon
_ „ ___ „„11 ___1<-____„„ T-1!___„ \ 7T7T7rr,/'^0'>panicle vaccines iium ecu cunuics. unis, me vililic-oj
structural proteins can be advantageously used to package
replicons from other alphaviruses, including other strains of
VEE.
[0013] Thus, the present invention provides a recombinant
alphavirus particle comprising (i) an alphavirus replicon
RNA encoding one or more heterologous RNA sequences,
wherein the replicon RNA comprises a 5' sequence which
initiates transcription of alphavirus RNA, one or more
nucleotide sequences which together encode those TC-83
alphavirus nonstructural proteins necessary for replication
of the replicon RNA, a means for expressing the polypeptide
encoded by the heterologous RNA(s), and a 3' RNA poly­
merase recognition sequence, (ii) a TC-83 derived capsid
protein; and (iii) alphavirus glycoproteins derived from
TC-83.
[0014] The present invention also provides other VEE
vaccine strains, especially those with characteristics similar
to those of TC-83, which can be engineered for use in
immunogenic replicon particle compositions.
[0015] Also provided is a population of infectious, propa­
gation-defective, alphavirus particles, wherein the popula­
tion comprises replicon particles comprising a VEE TC-83
replicon RNA comprising an alphavirus packaging signal,
one or more heterologous RNA sequence(s) encoding a
nucleic acid of interest and lacking sequences encoding
alphavirus structural proteins, and wherein the population
contains no more than 10 replication-competent TC-83 viral
particles per 10s TC-83 replicon particles.
[0016] Also provided is a composition comprising a popu­
lation of infectious, propagation-defective, alphavirus par­
ticles, wherein (1) each particle comprises an alphavirus
replicon RNA encoding one or more heterologous RNA
sequences and lacks sequences encoding any alphavirus
structural nroteins, 123 the nonulation has no detectable
replication competent viruses (RCV), as measured by pas­
sage on cell cultures, (3) the replicon RNA is derived from
TC-83, and wherein the population is formulated with a
pharmaceutically acceptable carrier. The alphavirus struc­
tural proteins can be derived from the alphavirus VEE
vaccine strain TC-83, a wild-type VEE strain, or other
strains of VEE containing one or more attenuating mutations
in the alphaviral genomic sequences encoding the structural
proteins. In a specific embodiment, the TC-83 structural
proteins may have one or more additional attenuating muta­
tions introduced, e.g. at El-81 (e.g. from Phe to He).
[0017] Also provided is a composition comprising a popu­
lation of infectious, propagation-defective, alphavirus par-
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
3
Dec. 1, 2005
tides, wherein (1) each particle comprises an alphavirus
replicon RNA encoding one or more heterologous RNA
sequences and lacks sequences encoding any alphavirus
structural proteins, (2) the structural proteins comprising the
coat of the particles are derived from VEETC83, and (3) the
population has no detectable replication competent viruses
(RCV), as measured by passage on cell cultures, and
wherein the population is formulated with a pharmaceuti­
cally acceptable carrier. In this composition, the alphavirus
replicon RNA is derived from a wild-type VEE strain or
other non-TC83 strains of VEE containing one or more
attenuating mutations in the alphaviral genomic sequences
contained within the replicon. In a specific embodiment, the
TC-83 structural proteins may have one or more additional
attenuating mutations introduced, e.g. at El-81 (e.g. from
Phe to He).
[0018] Also provided is a method of producing an immune
response in a subject, comprising administering to the sub­
ject an effective amount of an immunogenic composition
comprising a population of infectious, propagation-defec­
tive alphavirus particles in a pharmaceutically-acceptable
carrier, wherein the composition comprises particles com­
prising a VEE TC-83 replicon RNA comprising an alphavi­
rus packaging signal, one or more heterologous RNA
sequence(s) encoding an immunogen and lacking sequences
encoding alphavirus structural proteins, and wherein the
composition has less than 10 replication-competent TC-83
particles per 10s TC-83 replicon particles.
[0019] Also provided is a helper cell for producing an
infectious, propagation-defective alphavirus particle com­
prising (1) a VEETC83 replicon RNA comprising a heter­
ologous RNA sequence, for example, a coding sequence
heterologous to the virus, and lacking sequences encoding
alphavirus structural proteins; and (2) one or more nucleic
acids encoding the TC-83 stmctural proteins. Alternatively
the structural proteins can be selected from the group
consisting of wild-type VEE structural glycoproteins, VEE
3014 structural glycoproteins, VEE 3040 glycoproteins,
VEE 3042 glycoproteins, and VEE 3526 glycoproteins, but
preferably from among VEE structural glycoproteins which
contain amino acid substitutions that confer attenuated viru­
lence, and the VEE capsid is produced from the wild-type
sequence or from a sequence in which the auto-proteolytic
cleavage site has been deleted.
[0020] Also provided is a helper cell for producing an
infectious, propagation-defective alphavirus particle com­
prising (1) an alphavirus replicon RNA comprising a heter­
ologous RNA sequence, for example, a coding sequence
heterologous to the virus, and lacking sequences encoding
alphavirus structural proteins; and (2) one or more nucleic
acids encoding the TC-83 stmctural proteins.
[0021] The present invention further provides a method of
producing infectious, propagation-defective TC-83 replicon
particles comprising introducing into a population of cells a
recombinant DNA molecule encoding all the VEE stmctural
proteins, and a TC-83 replicon RNA encoding at least one
heterologous RNA, such that infectious, propagation-defec­
tive TC-83 replicon particles are produced, and wherein the
VEE stmctural glycoproteins are derived from one of the
following VEE strains: TC-83, 3014, 3040, 3042 and 3526.
These strains are referred to herein as VEETC83, VEE3014,
etc.
[0022] Also provided is a method of producing infectious,
propagation-defective alphavirus replicon particles compris­
ing introducing into a population of cells a recombinant
DNA molecule encoding all the VEETC83 structural proteins,
and an alphavirus replicon RNA encoding at least one
heterologous RNA, such that infectious, propagation-defec­
tive replicon particles are produced, and wherein the VEE
replicon RNA is derived from a wild-type VEE strain or
incorporates at least one attenuating mutations, such as the
mutation to an A at nucleotide 3.
[0023] A method of producing infectious, propagation-
defective alphavirus replicon particles comprising introduc­
ing into a population of cells (i) two recombinant nucleic
acid molecules, each of which encodes at least one, but not
all of VEE structural proteins and (ii) a TC-83 replicon RNA
encoding at least one heterologous RNA, wherein the two
recombinant nucleic acid molecules together encode all
VEE stmctural proteins required to produce infectious,
propagation-defective TC-83 replicon particles in the cells,
and further wherein the alphaviral stmctural proteins are
derived from one of the following VEE strains: TC-83,
3014, 3040, 3042 and 3526. These strains are typically
referred to in this application as “VEETC83”, “VEE3014,”
etc.
[0024] Also provided is a method of providing advanta­
geously purified, infectious, propagation-defective TC-83
replicon particles by heparin affinity chromatography, either
by column or batch purification methods. The unique hep­
arin-binding characteristics of the TC-83 derived replicon
particles allow for removal of contaminating proteins and
nucleic acids through a single purification step.
[0025] Also provided are methods of eliciting an immune
response in a subject, comprising administering to the sub­
ject an immunogenic amount of the population of replicon
particles of this invention.
[0026] The present invention is also applicable to the
production of live attenuated alphavirus vaccines, which
may or may not carry heterologous genes for expression in
the vaccinee, as described in U.S. Pat. No. 5,643,576, or live
attenuated alphavirus vectors which direct the expression of
functional RNAs (such as antisense, suppressing RNAs or
interfering RNAs or RNAs which encode therapeutic pro­
teins. The method of the present invention comprises the
steps of (a) introducing the TC-83 replicon nucleic acid into
a host cell, wherein said replicon nucleic acid contains at
least an alphavims packaging signal and at least one coding
sequence for a protein or functional RNA of interest express­
ible in said alphaviral replicon nucleic acid, wherein the host
cell is capable of expressing alphavirus structural proteins
required to produce ARPs, to produce a modified host cell;
(b) culturing said modified host cell in a medium under
conditions allowing expression of the stmctural proteins and
replication of the alphaviral replicon nucleic acid, and then
packaging of the alphaviral replicon nucleic acid to form
ARPs; (c), optionally separating the modified host cells from
the medium, and (d) after step (b) or (c) contacting the
modified host cells with an aqueous solution having an ionic
strength of at least approximately 0.20 M, desirably from
about 0.5 to about 5 M, (herein the “Release Medium”) to
release the ARPs into the aqueous solution to produce an
ARP-containing solution. The ionic strength of the Release
Medium can be achieved using salts which do not inactivate
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
4
Dec. 1, 2005
the virions or ARPs, and suitable salts include, but are not
limited to, sodium chloride, magnesium chloride, ammo­
nium chloride, ammonium acetate, potassium chloride, cal­
cium chloride, ammonium bicarbonate, and heparin Fast
Flow. Desirably the Release Medium comprises a buffer
with a pH from about 6 to about 9, preferably from about 6.5
to about 8.5. Where the cells are not separated from the
medium, the ionic strength of the medium can be raised by
the addition of solid salts or a concentrated solution to
provide the increased ionic strength for releasing the ARPs
(or virions) from the cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1 shows the elution profile of TC-83 virus
replicon particles during heparin affinity chromatography.
[0028] FIG. 2 shows the results of SDS-PAGE of TC-83
virus replicon particles after heparin affinity chromatogra­
phy, with the proteins visualized by silver staining and by
Western blotting using capsid-specific and glycoprotein-
specific antibodies and staining.
[0029] FIG. 3 is a plasmid map of the TC-83 replicon
cloning vector pVEK.
DETAILED DESCRIPTION OF THE
INVENTION
[0030] The following discussion and definitions are pro­
vided to improve the clarity of the present disclosure to one
of ordinary skill in the relevant art.
[0031] In the context of the present application, nm means
nanometer, ml means milliliter, VEE means Venezuelan
Equine Encephalitis virus, EMC means Encephalomyo-
carditis virus, BHK means baby hamster kidney cells, HA
means hemagglutinin gene, GFP means green fluorescent
protein gene, N means nucleocapsid, FACS means fluores­
cence activated cell sorter, IRES means internal ribosome
entry site, and FBS means Fetal Bovine Serum. The expres­
sion “E2 amino acid (e.g., Lys, Thr, etc.) number” indicates
designated amino acid at the designated residue of the E2
gene, and is also used to refer to amino acids at specific
residues in the El gene.
[0032] As used herein, the term “alphavirus” has its con­
ventional meaning in the art, and includes the various
species such as VEE, SFV, Sindbis, Ross River Virus,
Western Equine Encephalitis Virus, Eastern Equine
Encephalitis Virus, Chikungunya, S. A. AR86, Everglades
virus, Mucambo, Barmah Forest Virus, Middelburg Virus,
Pixuna Virus, O’nyong-nyong Virus, Getah Virus, Sagiyama
Virus, Bebaru Virus, Mayaro Virus, Una Virus, Aura Virus,
Whataroa Virus, Banbanki Virus, Kyzylagach Vims, High­
lands J Virus, Fort Morgan Vims, Ndumu Virus, and Buggy
Creek Vims. The preferred alphavimses used in the con­
structs and methods of the claimed invention are VEE, S.A.
AR86, Sindbis (e.g. TR339, see U.S. Pat. No. 6,008,035),
and SFV.
[0033] “Alphavirus-permissive cells” employed in the
methods of the present invention are cells that, upon trans­
fection with a complete viral RNA transcript, are capable of
producing viral particles. Alphavimses have a broad host
range. Examples of suitable packaging cells include, but are
not limited to, Vero cells, baby hamster kidney (BHK) cells,
chicken embryo fibroblast cells, DF-1, 293, 293T, Chinese
Hamster Ovary (CHO) cells, and insect cells.
[0034] As used herein, the phrases “attenuating mutation”
and “attenuating amino acid,” mean a nucleotide mutation
(which may or may not be in a region of the viral genome
encoding polypeptides) or an amino acid coded for by a
nucleotide mutation, which in the context of a live vims,
result in a decreased probability of the alphavirus causing
disease in its host (i.e., a loss of vimlence), in accordance
with standard terminology in the art. See, e.g., B. Davis, et
alMicrobiology 132 (3d ed. 1980), whether the mutation be
a substitution mutation, or an in-frame deletion or addition
mutation. The phrase “attenuating mutation” excludes muta­
tions which would be lethal to the vims, unless such a
mutation is used in combination with a “restoring” mutation
which renders the virus viable, albeit attenuated. Exemplary
attenuating mutations in VEE stmctural proteins include, but
are not limited to, those described in U.S. Pat. No. 5,505,947
to Johnston et al., U.S. Pat. No. 5,185,440 to Johnston et al.,
U.S. Pat. No. 5,643,576 to Davis et al., U.S. Pat. No.
5,792,462 to Johnston et al., and U.S. Pat. No. 5,639,650 to
Johnston et al., the disclosures of which are incorporated
herein in their entireties by reference. Specific attenuating
mutations for the VEE El glycoprotein include an attenu­
ating mutation at any one of amino acid positions 81, 272 or
253. Alphavirus replicon particles made from the VEE-3042
mutant contain an isoleucine substitution at El-81, (amino
acid 81 of the El protein) and virus replicon particles made
from the VEE-3040 mutant contain an attenuating mutation
at El-253. Specific attenuating mutations for the VEE E2
glycoprotein include an attenuating mutation at any one of
amino acid positions 76, 120, or 209. Alphavirus replicon
particles made from the VEE-3014 mutant contain attenu­
ating mutations at both El-272 and at E2-209 (see U.S. Pat.
No. 5,792,492). A specific attenuating mutation for the VEE
E3 glycoprotein includes an attenuating mutation consisting
of a deletion of amino acids 56-59. Virus replicon particles
made from the VEE-3526 mutant contain this deletion in E3
(aa56-59) as well as a second attenuating mutation at
El-253. For alphavimses generally, deletion or substitution
mutations in the cleavage domain between E3 and E2, which
result in the E3/E2 polyprotein not being cleaved, are
attenuating.
[0035] The terms “5' alphavirus replication recognition
sequence” and “3' alphavirus replication recognition
sequence” refer to the sequences found in alphavimses, or
sequences derived therefrom, that are recognized by the
nonstmctural alphavims replicase proteins and lead to rep­
lication of viral RNA. These are sometimes referred to as the
constmcts of this invention, the use of these 5' and 3' ends
will result in replication of the RNA sequence encoded
between the two ends. The 3' alphavims replication recog­
nition sequence as found in the alphavirus is typically
approximately 300 nucleotides in length, which contains a
more well defined, minimal 3' replication recognition
sequence. The minimal 3' replication recognition sequence,
conserved among alphaviruses, is a 19 nucleotide sequence
(Hill et al., J. Virology, 2693-2704, 1997). These sequences
can be modified by standard molecular biological techniques
to further minimize the potential for recombination or to
introduce cloning sites, with the proviso that they must be
recognized by the alphavims replication machinery.
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
5
Dec. 1, 2005
[0036] The term “minimal 5' alphavirus replication rec­
ognition sequence” refers to the minimal sequence that
allows recognition by the nonstructural proteins of the
alphavirus but does not result in significant packaging/
recombination of RNA molecules containing the sequence.
In a preferred embodiment, the minimal 5' alphavirus rep­
lication recognition sequence results in a fifty to one-
hundred fold decrease in the observed frequency of pack­
aging/recombination of the RNA containing that sequence.
Packaging/recombination of helpers can be assessed by
several methods, e.g. the method described bv Lu and Silver
(J. Virol. Methods 2001, 91(1): 59-65).
[0037] The terms “alphavirus RNAreplicon”, “alphavirus
replicon RNA”, “alphavirus RNA vector replicon”, “repli-
con”, and “vector replicon RNA” are used interchangeably
to refer to an RNA molecule expressing nonstructural pro­
tein genes such that it can direct its own replication (ampli­
fication) and comprises, at a minimum, 5' and 3' alphavirus
replication recognition sequences (which may be the mini­
mal sequences, as defined above, but may alternatively be
the entire regions from the alphavims), coding sequences for
alphavirus nonstructural proteins, and a polyadenylation
tract. It may additionally contain a promoter and/or an IRES.
Specific replicons useful in the claimed invention include: a
replicon based on VEETC83, herein referred to as a
“VEETC83 replicon”; a replicon based on the wild-type
sequence of VEE, herein referred to as a “VEE3000 repli­
con”; and a replicon based on VEE3000 but additionally
including one of the attenuating mutations present in TC83,
namely the mutation to an “A” at nucleotide 3, herein
referred to as “VEE3000 nt3A”.
[0038] The alphavirus RNA vector replicon is designed to
express a heterologous nucleic acid, e.g. a gene, of interest,
also referred to herein as a heterologous RNA or heterolo­
gous sequence, which can be chosen from a wide variety of
sequences derived from viruses, prokaryotes or eukaryotes.
Examples of categories of heterologous sequences include,
but are not limited to, immunogens, including antigenic
proteins, cytokines, toxins, therapeutic proteins, enzymes,
antisense sequences, and immune response modulators.
[0039] The alphavirus RNA replicons of this invention
may also be engineered to express alphavirus structural
proteins, thereby generating a vaccine against the alphavi-
rus(es) from which the stmctural proteins are derived.
Johnston et al. and Polo et al. (cited in the background)
describe numerous constructs for such alphavirus RNA
replicons, and such constructs are incorporated herein by
reference. Specific embodiments of the alphavirus RNA
replicons utilized in the claimed invention may contain one
or more attenuating mutations, an attenuating mutation
being a nucleotide deletion, addition, or substitution of one
or more nucleotide(s), or a mutation that comprises rear­
rangement or chimeric construction which results in a loss of
virulence in a live virus containing the mutation as com­
pared to the appropriate wild-type alphavirus. Examples of
an attenuating nucleotide substitution (resulting in an amino
acid change in the replicon) include a mutation at nsPl
amino acid position 538, nsP2 amino acid position 96, or
nsP2 amino acid position 372 in the alphavirus S.A.AR86.
[0040] The terms “alphavirus structural protein/pro-
tein(s)” refers to one or a combination of the structural
proteins encoded by alphaviruses. These are produced by the
virus as a polyprotein and are represented generally in the
literature as C-E3-E2-6k-El. E3 and 6k serve as membrane
translocation/transport signals for the two glycoproteins, E2
and El. Thus, use of the term El herein can refer to El,
E3-E1, 6k-El, or E3-6k-El, and use of the term E2 herein
can refer to E2, E3-E2, 6k-E2, or E3-6k-E2.
[0041] The term “helper(s)” or helper constructs refers to
a nucleic acid molecule that is capable of expressing one or
more alphavirus structural proteins.
[0042] The terms “helper cell” and “packaging cell” are
used interchangeably herein and refer to the cell in which
alphavirus replicon particles are produced. The helper cell
comprises a set of helpers that encode one or more alphavi­
rus structural proteins. As disclosed herein, the helpers may
be RNA or DNA. The cell can be any cell that is alphavirus-
permissive. In certain embodiments of the claimed inven­
tion, the helper or packaging cell may additionally include
a heterologous RNA-dependent RNA polymerase and/or a
sequence-specific protease.
[0043] The terms “alphavirus replicon particles”, “virus
replicon particles”, “VRPs” or “recombinant alphavirus
particles”, used interchangeably herein, mean a virion-like
structural complex incorporating an alphavirus replicon
RNA that expresses one or more heterologous RNA
sequences. Typically, the virion-like structural complex
includes one or more alphavirus structural proteins embed­
ded in a lipid envelope enclosing a nucleocapsid comprised
of capsid and replicon RNA. The lipid envelope is typically
derived from the plasma membrane of the cell in which the
particles are produced. Preferably, the alphavirus replicon
RNA is surrounded by a nucleocapsid structure comprised of
the alphavirus capsid protein, and the alphavirus glycopro­
teins are embedded in the cell-derived lipid envelope. These
replicon particles are propagation-defective (or synony­
mously “replication defective”), which means that the par­
ticles produced in a given host cell cannot produce progeny
particles in the host cell, due to the absence of the helper
function, i.e. the alphavirus structural proteins required for
packaging the replicon nucleic acid. However, the replicon
nucleic acid is capable of replicating itself and being
expressed within the host cell into which it has been intro­
duced. Replicon particles of this invention may be referred
to as VEETC83 replicon particles, and this refers to particles
comprising either a TC83 replicon RNA or TC83 structural
proteins, or both a TC83 replicon RNA and TC83 structural
proteins.
[0044] Any amino acids which occur in the amino acid
sequences referred to in the specification have their usual
three- and one-letter abbreviations routinely used in the art:
A, Ala, Alanine; C, Cys, Cysteine; D, Asp, Aspartic Acid; E,
Glu, Glutamic Acid; F, Phe, Phenylalanine; G, Gly, Glycine;
H, His, Histidine; I, lie, Isoleucine; K, Lys, Lysine; L, Leu,
Leucine; M, Met, Methionine; N, Asn, Asparagine; P, Pro,
Pro line; Q, Gin, Glutamine; R, Arg, Arginine; S, Ser, Serine;
T, Thr, Threonine; V, Val, Valine; W, Try, Tryptophan; Y, Tyr,
Tyrosine.
[0045] As used herein, expression directed by a particular
sequence is the transcription of an associated downstream
sequence, i.e. production of messenger RNA from a DNA
molecule or production of messenger RNA from an alphavi­
rus subgenomic promoter. If appropriate and desired for the
particular application, the transcribed mRNA is then trans-
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
6
Dec. 1, 2005
lated, i.e. protein is synthesized. Thus, in one embodiment of
this invention, the replicon or helper construct comprises a
subgenomic promoter which directs transcription of a mes­
senger RNA encoding the heterologous nucleic acid of
interest (NOI) or the transcription of an mRNA encoding
one or more alphavirus structural proteins, respectively.
These mRNAs are “capped” within the eukaryotic cell, i.e.
a methyl-7-guanosine (5')pppN stmcture is present at the 5'
end of the mRNA (the “cap” or “5“cap”), and this cap is
recognized by the translation initiation factors that synthe­
size protein from the mRNA. Thus, the 26S promoter directs
transcription, and the “cap” provides the initiation signal for
translation.
[0046] In another embodiment, the replicon or helper
construct comprises a promoter that directs transcription; an
IRES element; and a coding sequence, and the IRES element
is operably located such that translation of the coding
sequence is via a cap-independent mechanism directed by
the IRES element, either in whole or in part, described in
detail in WIPO Publication No. WO 2004/085660. In par­
ticular, control of nucleic acid expression at the level of
translation is accomplished by introducing an internal ribo­
some entry site (IRES) downstream of an alphavirus 26S
subgenomic promoter and upstream of the coding sequence
to be translated. The IRES element is positioned so that it
directs translation of the mRNA, thereby minimizing, lim­
iting or preventing initiation of translation of the mRNA
from the 5' cap. This “IRES-directed,” cap-independent
translation does not require or result in any significant
modification of alphavirus non-structural protein genes that
could alter replication and transcription. In specific embodi­
ments, the replicon and/or helper construct can comprise a
spacer nucleic acid located between the promoter and the
IRES element. The spacer nucleic acid can comprise or
consist of any random or specific non-coding nucleic acid
sequence which is of a length sufficient to prevent at least
some, and in some embodiments, all translation from the 5'
cap of a messenger RNA, such that translation is then
directed by the IRES, in part or in whole. Alternatively, the
spacer nucleic acid can be of a length and sequence structure
that imparts sufficient secondary structure to the nucleic acid
to prevent at least some and possibly all translation activity
from the 5' cap of a messenger RNA.
[0047] Suitable IRES elements include, but are not limited
to, viral IRES elements from picornaviruses, e.g., poliovirus
(PV) or the human enterovirus 71, e.g. strains 7423/MS/87
and BrCr thereof; from encephalomyocarditis virus
(EMCV); from foot-and-mouth disease virus (FMDV); from
flaviviruses, e.g., hepatitis C virus (HCV); from pestiviruses,
~ ~ __i a.
CA£,., dfUNMVfU J)Wlllti Itvtl VliUJ) (k,Jl V ), liULLl ItllUVllUSW,
e.g., murine leukemia virus (MLV); from lentiviruses, e.g.,
simian immunodeficiency virus (SIV); from cellular mRNA
IRES elements such as those from translation initiation
factors, e.g., elF4G or DAP5; from transcription factors,
e.g., c-Myc (Yang and Sarnow, Nucleic Acids Research 25:
2800-2807 (1997)) or NF-KB-rcprcssing factor (NRF); from
growth factors, e.g., vascular endothelial growth factor
(VEGF), fibroblast growth factor (FGF-2) and platelet-
derived growth factor B (PDGF B); from homeotic genes,
e.g., Antennapedia; from survival proteins, e.g., X-linked
inhibitor of apoptosis (XIAP) or Apaf-1; from chaperones,
e.g., immunoglobulin heavy-chain binding protein BiP
(Martinez-Salas et al., Journal of General Virology 82:
973-984, (2001)), from plant viruses, as well as any other
IRES elements now known or later identified.
[0048] In specific embodiments, the IRES element of this
invention can be derived from, for example, encephalomyo­
carditis virus (EMCV, GenBank accession #NC001479),
cricket paralysis virus (GenBank accession #AF218039),
Drosophila C virus (GenBank accession #AF014388),P/a«-
tia stali intestine virus (GenBank accession #AB006531),
Rhopalosiphum padi virus (GenBank accession #
AF022937), Himetobi P vims (GenBank accession
#AB017037), acute bee paralysis virus (GenBank accession
#AF150629), Black queen cell vims (GenBank accession
#AF183905), Triatoma virus (GenBank accession
#AF178440), Acyrthosiphon pisum vims (GenBank acces­
sion #AF024514), infectious flacherie vims (GenBank
accession #AB000906), and/or Sacbrood vims (Genbank
accession # AF092924). In addition, synthetic IRES ele­
ments have been described, which can be designed, accord­
ing to methods know in the art to mimic the function of
naturally occurring IRES elements (see Chappell, S A et al.
Proc. Natl. Acad. Sci. USA (2000) 97(4): 1536-41.
[0049] In specific embodiments, the IRES element can be
an insect IRES element or other non-mammalian IRES
element that is functional in the particular helper cell line
chosen for packaging of the recombinant alphavirus par­
ticles of this invention, but would not be functional, or
would be minimally functional, in a target host cell for the
particles (e.g. a human subject). This is useful for those
NOIs which are either toxic to the packaging cell or are
detrimental to the alphavims packaging process.
[0050] The phrases “structural protein” or “alphavirus
stmctural protein” as used herein refer to one or more of the
alphaviral-encoded proteins which are required for packag­
ing of the RNA replicon, and typically include the capsid
protein, El glycoprotein, and E2 glycoprotein in the mature
alphavirus (certain alphavimses, such as Semliki Forest
Virus, contain an additional protein, E3, in the mature coat).
The term “alphavims structural protein(s)” refers to one or
a combination of the stmctural proteins encoded by alphavi­
mses. These are synthesized (from the viral genome) as a
polyprotein and are represented generally in the literature as
C-E3-E2-6k-El. E3 and 6k serve as membrane transloca­
tion/transport signals for the two glycoproteins, E2 and El.
Thus, use of the term El herein can refer to El, E3-E1,
6k-El, or E3-6k-El, and use of the term E2 herein can refer
to E2, E3-E2, 6k-E2, or E3-6k-E2.
[0051] As described herein, the nucleic acid sequences
encoding stmctural proteins of the alphavirus are distributed
among one or more helper nucleic acid molecules (e.g., a
first helper RNA (or DNA) and a second helper RNA (or
DNA)). In addition, one or more structural proteins may be
located on the same molecule as the replicon nucleic acid,
provided that at least one stmctural protein is deleted from
the replicon RNA such that the replicon and resulting
alphavirus particle arc propagation defective with respect to
the production of further alphavims particles. As used
herein, the terms “deleted” or “deletion” mean either total
deletion of the specified segment or the deletion of a
sufficient portion of the specified segment to render the
segment inoperative or nonfunctional, in accordance with
standard usage. See, e.g., U.S. Pat. No. 4,650,764 to Temin
et al. Distribution of the helper nucleic acid sequences
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
7
Dec. 1, 2005
among multiple nucleic acid molecules minimizes the fre­
quency at which replication competent vims (RCV) are
generated through recombination events. In the case of the
DNA helper constructs that do not employ alphaviral rec­
ognition signals for replication and transcription, the theo­
retical frequency of recombination is lower than the bipartite
RNA helper systems that employ such signals.
[0052] The helper cell, also referred to as a packaging cell,
used to produce the infectious, propagation defective
alphavirus particles, must express or be capable of express­
ing alphavirus stmctural proteins sufficient to package the
replicon nucleic acid. The structural proteins can be pro­
duced from a set of RNAs, typically two, that are introduced
into the helper cell concomitantly with or prior to introduc­
tion of the replicon vector. The first helper RNA includes
RNA encoding at least one alphavirus structural protein but
does not encode all alphavims structural proteins. The first
helper RNA may comprise RNA encoding the alphavirus El
glycoprotein, but not encoding the alphavims capsid protein
and the alphavims E2 glycoprotein. Alternatively, the first
helper RNA may comprise RNA encoding the alphavirus E2
glycoprotein, but not encoding the alphavims capsid protein
and the alphavirus El glycoprotein. In a further embodi­
ment, the first helper RNA may comprise RNA encoding the
alphavirus El glycoprotein and the alphavims E2 glycopro­
tein, but not the alphavirus capsid protein. In a fourth
embodiment, the first helper RNA may comprise RNA
encoding the alphavirus capsid, but none of the alphavims
glycoproteins. In a fifth embodiment, the first helper RNA
may comprise RNA encoding the capsid and one of the
glycoproteins, i.e. either El or E2, but not both.
[0053] In preferred embodiments employing two helper
RNAs, in combination with any one of these first helper
RNAs, the second helper RNA encodes the one or more
alphavirus structural proteins not encoded by the first helper
RNA. For example, where the first helper RNA encodes only
the alphavirus El glycoprotein, the second helper RNA
encodes both the alphavirus capsid protein and the alphavi­
rus E2 glycoprotein. Where the first helper RNA encodes
only the alphavirus capsid protein, the second helper RNA
encodes both the alphavirus glycoproteins. Where the first
helper RNA encodes only the alphavirus E2 glycoprotein,
the second helper RNA encodes both the alphavirus capsid
protein and the alphavirus El glycoprotein. Where the first
helper RNA encodes both the capsid and alphavirus El
glycoprotein, the second helper RNA may include RNA
encoding one or both of the alphavirus capsid protein and the
alphavirus E2 glycoprotein.
[0054] In all of the helper nucleic acids, it is understood
that these molecules further comprise sequences necessary
for expression (encompassing translation and where appro­
priate, transcription or replication signals) of the encoded
structural protein sequences in the helper cells. Such
sequences can include, for example, promoters (either viral,
prokaryotic or eukaryotic, inducible or constitutive), IRE-
Scs, and 5' and 3' viral rcplicasc recognition sequences. In
the case of the helper nucleic acids expressing one or more
glycoproteins, it is understood from the art that these
sequences are advantageously expressed with a leader or
signal sequence at the N-terminus of the stmctural protein
coding region in the nucleic acid constmcts. The leader or
signal sequence can be derived from the alphavirus, for
example E3 or 6k, or it can be a heterologous sequence such
as a tissue plasminogen activator signal peptide or a syn­
thetic sequence. Thus, as an example, a first helper nucleic
acid may be an RNA molecule encoding capsid-E3-El, and
the second helper nucleic acid may be an RNA molecule
encoding capsid-E3-E2. Alternatively, the first helper RNA
can encode capsid alone, and the second helper RNA can
encode E3-E2-6k-El. Additionally, the packaging signal(s)
or “encapsulation sequence(s)” that are present in the viral
genome are not present in all of the helper nucleic acids.
Preferably, any such packaging signal(s) are deleted from all
of the helper nucleic acids.
Production of Alphavims Particles
[0055] Alphavims replicon particles of this invention are
produced by introducing helper constructs and replicon
nucleic acids into a helper cell so that the helper and replicon
molecules function to produce alphavims replicon particles.
In embodiments utilizing RNA helpers, the helpers can be
introduced into the cells in a number of ways. The RNAs can
be introduced as RNA or DNA molecules that can be
expressed in the helper cell without integrating into the cell
genome. Methods of introduction include electroporation,
viral vectors (e.g. SV40, adenovims, nodavims, astrovims),
and lipid-mediated transfection. Alternatively, they can be
expressed from one or more expression cassettes that have
been stably transformed into the cells, thereby establishing
packaging cell lines (see, for example, U.S. Pat. No. 6,242,
259).
[0056] In other embodiments, the helper is a single DNA
molecule which encodes all the polypeptides necessary for
packaging the viral replicon RNA into infective alphavirus
replicon particles. The single DNA helper can be introduced
into the packaging cell by any means known to the art,
including by electroporation, typically with an increase in
voltage as compared to that required for the uptake of RNA,
but a voltage not sufficiently high to destroy the ability of the
packaging cells to produce infectious alphavirus replicon
particles. The DNA helper can be introduced prior to,
concomitantly, with, or after introduction/expression of the
alphavirus RNA vector replicon. Alternatively, the helper
function, in this format and under an inducible promoter, can
be incorporated into the packaging cell genome prior to the
introduction/expression of the alphavirus RNA vector rep­
licon, and then induced with the appropriate stimulus just
prior to, concomitant with, or after the introduction of the
alphavirus RNA vector replicon.
[0057] Recombinant DNA molecules that express the
alphavirus structural proteins can also be generated from a
single helper that resolves itself into two separate molecules
in vivo. Thus, the advantage of using a single helper in terms
of ease of manufacturing and efficiency of production is
preserved, while the advantages of a bipartite helper system
are captured in the absence of employing a bipartite expres­
sion system. A DNA helper construct can be used, while in
a second set an RNA helper vector is used. Such systems are
described in detail in Smith et al. “Alphavirus Replicon
Vector Systems”, U.S. Patent Publication 2003-0119182A1,
incorporated herein by reference.
[0058] For the DNA helper constmcts, a promoter for
directing transcription of RNA from DNA, i.e. a DNA
dependent RNA polymerase, is employed. In the present
context, a promoter is a sequence of nucleotides recognized
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
8
Dec. 1, 2005
by a polymerase and sufficient to cause transcription of an
associated (downstream) sequence. In some embodiments of
the claimed invention, the promoter is constitutive (see
below). Alternatively, the promoter may be regulated, i.e.,
not constitutively acting to cause transcription of the asso­
ciated sequence. If inducible, there are sequences present
which mediate regulation of expression so that the associ­
ated sequence is transcribed only when (i) an inducer
molecule is present in the medium in or on which the cells
are cultivated, or (ii) conditions to which the cells are
exposed are changed to be inducing conditions. In the
present context, a transcription regulatory sequence includes
a promoter sequence and can further include cis-active
sequences for regulated expression of an associated
sequence in response to environmental signals.
[0059] In the RNA helper embodiments, the promoter is
utilized to synthesize RNA in an in vitro transcription
reaction, and specific promoters suitable for this use include
the SP6, T7, and T3 RNA polymerase promoters. In the
DNA helper embodiments, the promoter functions within a
cell to direct transcription of RNA. Potential promoters for
in vivo transcription of the construct include eukaryotic
promoters such as RNA polymerase II promoters, RNA
polymerase III promoters, or viral promoters such as MMTV
and MOSV LTR, SV40 early region, RSV or CMV. Many
other suitable mammalian and viral promoters for the
present invention are available in the art. Alternatively, DNA
dependent RNA polymerase promoters from bacteria or
bacteriophage, e.g. SP6, T7, and T3, may be employed for
use in vivo, with the matching RNA polymerase being
provided to the cell, either via a separate plasmid, RNA
vector, or viral vector. In a specific embodiment, the match­
ing RNA polymerase can be stably transformed into a helper
cell line under the control of an inducible promoter.
[0060] DNA constructs that function within a cell can
function as autonomous plasmids transfected into the cell or
they can be stably transformed into the genome. In these
embodiments, the promoter may be a constitutive promoter,
i.e. a promoter which, when introduced into a cell and
operably linked to a downstream sequence, directs transcrip­
tion of the downstream sequence upon introduction into the
cell, without the need for the addition of inducer molecules
or a change to inducing conditions. Alternatively, the pro­
moter may be inducible, so that the cell will only produce the
functional messenger RNA encoded by the constmct when
the cell is exposed to the appropriate stimulus (inducer).
When using an inducible promoter, the helper constructs are
introduced into the packaging cell concomitantly with, prior
to, or after exposure to the inducer, and expression of the
alphavirus structural proteins occurs when both the con­
structs and the inducer arc present. Alternatively, constmcts
designed to function within a cell can be introduced into the
cell via a viral vector, e.g. adenovirus, poxvirus, adeno-
associated virus, SV40, retrovirus, nodavirus, picornavirus,
vesicular stomatitis virus, and baculoviruses with mamma­
lian pol II promoters.
[0061] Once an RNA transcript (mRNA) encoding the
helper or alphavirus RNA replicon vectors of this invention
is present in the helper cell (either via in vitro or in vivo
approaches, as described above), it is eventually translated
to produce the encoded polypeptides or proteins. In certain
embodiments, the alphavirus RNA vector replicon is tran­
scribed in vitro from a DNA plasmid and then introduced
into the helper cell by electroporation. In other embodi­
ments, the RNA vector replicon of this invention is tran­
scribed in vivo from a DNA vector plasmid that is trans­
fected into the helper cell (e.g. see U.S. Pat. No. 5,814,482),
or it is delivered to the helper cell via a virus or virus-like
particle.
[0062] In the embodiments of this invention, one or more
of the nucleic acids encoding the alphavirus RNA replicon
or helpers is comprised of sequences derived from the
VEETC83 genome, which contains mutations that contrib­
ute to the attenuated nature of the TC83 vaccine strain, as
described hereinabove. In addition, one or more of the
nucleic acids encoding the alphavirus stmctural proteins,
i.e., the capsid, El glycoprotein and E2 glycoprotein, or the
replicon construct, may contain one or more additional
attenuating mutations.
Methods for Immunizing Subjects
[0063] As used herein, “eliciting an immune response”
and “immunizing a subject” includes the development, in a
subject, of a humoral and/or a cellular immune response to
a protein and/or polypeptide produced by the particles
and/or compositions of this invention (e.g. an immunogen,
an antigen, an immunogenic peptide, and/or one or more
epitopes). A “humoral” immune response, as this term is
well known in the art, refers to an immune response com­
prising antibodies, while a “cellular” immune response, as
this term is well known in the art, refers to an immune
response comprising T-lymphocytes and other white blood
cells, especially the immunogen-specific response by HLA-
restricted cytolytic T-cells, i.e., “CTLs.” Acellular immune
response occurs when the processed immunogens, i.e., pep­
tide fragments, are displayed in conjunction with the major
histocompatibility complex (MHC) HLAproteins, which are
of two general types, class I and class II. Class I HLA-
restricted CTLs generally bind 9-mer peptides and present
those peptides on the cell surface. These peptide fragments
in the context of the HLA Class I molecule are recognized
by specific T-Cell Receptor (TCR) proteins on T-lympho-
cytes, resulting in the activation of the T-cell. The activation
can result in a number of functional outcomes including, but
not limited to, expansion of the specific T-cell subset result­
ing in destruction of the cell bearing the HLA-peptide
complex directly through cytotoxic or apoptotic events or
the activation of non-destructive mechanisms, e.g., the pro­
duction of interferon/cytokines. Presentation of immuno­
gens via Class I MHC proteins typically stimulates a CD8+
CTL response.
[0064] Another aspect of the cellular immune response
involves the HLA Class II-restricted T-cell responses,
involving the activation of helper T-cells, which stimulate
and focus the activity of nonspecific effector cells against
cells displaying the peptide fragments in association with the
MHC molecules on their surface. At least two types of
helper cells are recognized: T-helper f cells (Thf), which
secrete the cytokines interleukin 2 (IL-2) and interferon-
gamma and T-helper 2 cells (Th2), which secrete the cytok­
ines interleukin 4 (IL-4), interleukin 5 (IL-5), interleukin 6
(IL-6) and interleukin 10 (IL-f 0). Presentation of immuno­
gens via Class II MHC proteins typically elicits a CD4+ CTL
response as well as stimulation of P lymphocytes, which
leads to an antibody response.
[0065] An “immunogenic polypeptide,”“immunogenic
peptide,” or “immunogen” as used herein includes any
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
9
Dec. 1, 2005
peptide, protein or polypeptide that elicits an immune
response in a subject and in certain embodiments, the
immunogenic polypeptide is suitable for providing some
degree of protection to a subject against a disease. These
terms can be used interchangeably with the term “antigen.”
[0066] In certain embodiments, the immunogen of this
invention can comprise, consist essentially of or consist of
one or more “epitopes.” An “epitope” is a set of amino acid
residues which is involved in recognition by a particular
immunoglobulin. In the context of T cells, an epitope is
defined as the amino acid residues necessary for recognition
by T cell receptor proteins and/or MHC receptors. In an
immune system setting, in vivo or in vitro, an epitope refers
to the collective features of a molecule, such as primary,
secondary and/or tertiary peptide structure, and/or charge,
that together form a site recognized by an immunoglobulin,
T cell receptor and/or HLA molecule. In the case of a B-cell
(antibody) epitope, it is typically a minimum of 3-4 amino
acids, preferably at least 5, ranging up to approximately 50
amino acids. Preferably, the humoral response-inducing
epitopes are between 5 and 30 amino acids, usually between
12 and 25 amino acids, and most commonly between 15 and
20 amino acids. In the case of a T-cell epitope, an epitope
includes at least about 7-9 amino acids, and for a helper
T-cell epitope, at least about 12-20 amino acids. Typically,
such a T-cell epitope will include between about 7 and 15
amino acids, e.g., 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino
acids.
[0067] The alphavirus particles of this invention are
employed to express a nucleic acid encoding an immuno­
genic polypeptide in a subject (e.g., for vaccination) or for
immunotherapy (e.g., to treat a subject with cancer or
tumors). Thus, in the case of vaccines, the present invention
thereby provides methods of eliciting an immune response
in a subject, comprising administering to the subject an
immunogenic amount of a population of alphavirus par­
ticles.
[0068] An “immunogenic amount” is an amount of the
infectious alphavirus particles which is sufficient to evoke an
immune response in the subject to which the pharmaceutical
formulation comprising the alphavirus particles is adminis­
tered. An amount of from about 104 to about 109, especially
106 to 10s, infectious units, per dose is believed suitable,
depending upon the age and species of the subject being
treated. Exemplary pharmaceutically acceptable carriers
include, but are not limited to, sterile pyrogen-free water and
sterile pyrogen-free physiological saline solution.
[0069] A “subject” of this invention includes, but is not
limited to, warm-blooded animals, e.g., humans, non-human
primates, horses, cows, cats, dogs, pigs, rats, and mice.
Administration of the various compositions of this invention
(e.g., nucleic acids, particles, populations, pharmaceutical
compositions) can be accomplished by any of several dif­
ferent routes. In specific embodiments, the compositions can
be administered intramuscularly, subcutaneously, intraperi-
toneally, intradermally, intranasally, intracranially, sublin­
gually, intravaginally, intrarectally, orally, or topically. The
compositions herein may be administered via a skin scari­
fication method, or transdermally via a patch or liquid. The
compositions may be delivered subdermally in the form of
a biodegradable material which releases the compositions
over a period of time.
[0070] The compositions of this invention can be used
prophylactically to prevent disease or therapeutically to treat
disease. Diseases that can be treated include infectious
disease caused by viruses, bacteria, fungi or parasites, and
cancer. Chronic diseases involving the expression of aber­
rant or abnormal proteins or the over-expression of normal
proteins, can also be treated, e.g., Alzheimer’s, disease
multiple sclerosis, stroke, etc.
[0071] The compositions of this invention can be opti­
mized and combined with other vaccination regimens to
provide the broadest (i.e., all aspects of the immune
response, including those features described hereinabove)
cellular and humoral responses possible. In certain embodi­
ments, this can include the use of heterologous prime-boost
strategies, in which the compositions of this invention are
used in combination with a composition comprising a dif­
ferent modality for vaccination, such as one or more of the
following: immunogens derived from a pathogen or tumor,
recombinant immunogens, naked nucleic acids, nucleic
acids formulated with lipid-containing moieties, non-al-
phavirus vectors (including but not limited to pox vectors,
adenoviral vectors, herpes vectors, vesicular stomatitis virus
vectors, paramyxoviral vectors, parvovirus vectors,
papovavirus vectors, retroviral vectors), and other alphavi-
rus vectors. The viral vectors can be virus-like particles or
nucleic acids. The alphavirus vectors can be replicon-con-
taining particles, DNA-based replicon-containing vectors
(sometimes referred to as an “ELVIS” system, see, for
example, U S. Pat. No. 5,814,482) or naked RNA vectors. In
specific embodiments, VRPs can be used as a priming
inoculation, followed by one or more boosting inoculations
using one of the above-listed compositions. Alternatively,
VRPs can be used in one or more boosting inoculations
following a priming inoculation with one of the above-listed
compositions.
[0072] The compositions of the present invention can also
be employed to produce an immune response against
chronic or latent infectious agents, which typically persist
because they fail to elicit a strong immune response in the
subject. Illustrative latent or chronic infectious agents
include, but are not limited to, hepatitis B, hepatitis C,
Epstein-Barr Virus, herpes viruses, human immunodefi­
ciency virus, and human papilloma viruses. Alphavirus
replicon particles of this invention encoding peptides and/or
proteins from these infectious agents can be administered to
a cell or a subject according to the methods described herein.
[0073] Alternatively, the immunogenic protein or peptide
can be any tumor or cancer cell antigen. Preferably, the
tumor or cancer antigen is expressed on the surface of the
ca.ncer cell. Exemplary cancer antigens for specific breast
cancers are the HER2 and BRCA1 antigens. Other illustra­
tive cancer and tumor cell antigens are described in S. A.
Rosenberg, (1999) Immunity 10:281) and include, but are
not limited to, MART-l/MelanA, gplOO, tyrosinase, TRP-1,
TRP-2, MAGE-1, MAGE-3, GAGE-1/2, BAGE, RAGE,
NY-ESO-1, CDK-4, |3-catcnin, MUM-1, Caspasc-8,
KIAA0205, HPVE&, SART-1, PRAME, pl5 and p53 anti­
gens, Wilms’ tumor antigen, tyrosinase, carcinoembryonic
antigen (CEA), prostate specific antigen (PSA), prostate-
specific membrane antigen (PSMA), prostate stem cell anti­
gen (PSCA), human aspartyl (asparaginyl) (3-hydroxylase
(HAAH), and EphA2 (an epithelial cell tyrosine kinase, see
International Patent Publication No. WO 01/12172).
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
10
Dec. 1, 2005
[0074] The immunogenic polypeptide or peptide of this
invention can also be a “universal” or “artificial” cancer or
tumor cell antigen as described in international patent pub­
lication WO 99/51263, which is incorporated herein by
reference in its entirety for the teachings of such antigens.
[0075] In various embodiments, the heterologous nucleic
acid of this invention can encode an antisense nucleic acid
sequence. An “antisense” nucleic acid is a nucleic acid
molecule (i.e., DNA or RNA) that is complementary (i.e.,
able to hybridize in vivo or under stringent in vitro condi­
tions) to all or a portion of a nucleic acid (e.g., a gene, a
cDNA and/or mRNA) that encodes or is involved in the
expression of nucleic acid that encodes a polypeptide to be
targeted for inhibited or reduced production by the action of
the antisense nucleic acid. Where the antisense nucleic acid
is complementary to a portion of the nucleic acid encoding
the polypeptide to be targeted, the antisense nucleic acid
should hybridize close enough to the 5' end of the nucleic
acid encoding the polypeptide such that it inhibits translation
of a functional polypeptide. Typically, this means that the
antisense nucleic acid should be complementary to a
sequence that is within the 5' half or third of the nucleic acid
to which it hybridizes.
[0076] An antisense nucleic acid of this invention can also
encode a catalytic RNA (i.e., a ribozyme) that inhibits
expression of a target nucleic acid in a cell by hydrolyzing
an mRNA encoding the targeted gene product. Additionally,
hammerhead RNA can be used as an antisense nucleic acid
to prevent intron splicing. An antisense nucleic acid of this
invention can be produced and tested according to protocols
routine in the art for antisense technology.
[0077] Standard techniques for cloning, DNA isolation,
amplification and purification, for enzymatic reactions
involving DNA ligase, DNA polymerase, restriction endo­
nucleases and the like, and various separation techniques are
those known and commonly employed by those skilled in
the art. A number of standard techniques are described in
Sambrook et al. (1989) Molecular Cloning, Second Edition,
Cold Spring Harbor Laboratory, Plainview, N.Y.; Maniatis et
al. (1982) Molecular Cloning, Cold Spring Harbor Labora­
tory, Plainview, N.Y.; Wu (ed.) (1993) Meth. Enzymol. 218,
Part I; Wu (ed.) (1979) Meth. Enzymol. 68; Wu et al. (eds.)
(1983) Meth. Enzymol. 100 and 101; Grossman and Mold-
ave (eds.) Meth. Enzymol. 65; Miller (ed.) (1972) Experi­
ments in Molecular Genetics, Cold Spring Harbor Labora­
tory, Cold Spring Harbor, N.Y.; Old and Primrose (1981)
Principles of Gene Manipulation, University of California
Press, Berkeley; Schleif and Wensink (1982) Practical
Methods in Molecular Biology; Glover (ed.) (1985) DNA
Cloning Vol. I and II, IRL Press, Oxford, UK; Hames and
Higgins (eds.) (1985) Nucleic Acid Hybridization, IRL
Press, Oxford, UK; Setlow and Hollaender (1979) Genetic
Engineering: Principles and Methods, Vols. 1-4, Plenum
Press, New York; and Ausubel et al. (1992) Current Proto­
cols in Molecular Biology, Greene/Wiley, New York, N.Y.,
and in other sources referenced herein. Abbreviations and
nomenclature, where employed, are deemed standard in the
field and commonly used in professional journals such as
those cited herein.
[0078] All references cited in the present application are
incorporated by reference herein to the extent that there is no
inconsistency with the present disclosure.
[0079] When a Markush group or other grouping is used
herein, all individual members of the group and all combi­
nations and subcombinations possible of the group are
intended to be individually included in the disclosure.
Whenever a range is given in the specification, for example,
a temperature range, a time range, or a composition range,
all intermediate ranges and subranges, as well as all indi­
vidual values included in the ranges given are intended to be
included in the disclosure.
[0080] As used herein, “comprising” is synonymous with
“including,’’“containing,” or “characterized by,” and is
inclusive or open-ended and does not exclude additional,
unrecited elements or method steps. As used herein, “con­
sisting of’ excludes any element, step, or ingredient not
specified in the claim element. As used herein, “consisting
essentially of” does not exclude materials or steps that do not
materially affect the basic and novel characteristics of the
claim. Any recitation herein of the term “comprising”,
particularly in a description of components of a composition
or in a description of elements of a device in the specifica­
tion or claims, can be exchanged with “consisting essentially
of’ or “consisting of”.
[0081] One of ordinary skill in the art will appreciate that
methods, techniques, procedures, e.g., collection and/or
purification techniques or procedures, starting materials,
culture media, and reagents other than those specifically
exemplified can be employed in the practice of the invention
without resort to undue experimentation. All art-known
functional equivalents, of any such methods, techniques,
procedures, starting materials, culture media, and reagents
are intended to be included in this invention.
[0082] Although the description herein contains many
specific recitations and examples, these should not be con­
strued as limiting the scope of the invention, but as merely
providing illustrations of some of the embodiments of the
invention. All references cited herein are hereby incorpo­
rated by reference to the extent that there is no inconsistency
with the disclosure of this specification. Some references
provided herein are incorporated by reference herein to
provide details concerning additional starting materials,
additional methods of synthesis, additional methods of
analysis and additional uses of the invention.
[0083] The following examples are provided for illustra­
tive purposes, and are not intended to limit the scope of the
invention as claimed herein. Any variations in the exempli­
fied articles which occur to the skilled artisan are intended
to fall within the scope of the present invention.
EXAMPLES
Example 1
Production of TC-83 Replicons
[0084] A replicon plasmid based on the TC-83 strain of
VEE was produced from a TC-83 infectious cDNA clone,
pVE/IC-92, obtained from the Centers for Disease Control
and Prevention. The sequence of this clone was published by
Kinney et al. (1993) J. Virol. 67:1269. The pVE/IC-92
sequence differs from the TC-83 virus genomic sequence by
the presence of an Ala-Val mutation at El-119 (a cloning
artifact introduced by Kinney) and three silent mutations in
nspl (at 1613A^G; at 1616C—»A; at 1619T—»C) purposely
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
11
Dec. 1, 2005
introduced to distinguish the clone-derived virus from the
genomic sequence. The present inventors have identified an
additional silent mutation at El position in the pVE/IC-92
clone. By “silent” is meant that the change in the nucleic
acid sequence does not cause a change in the amino acid that
is encoded by that nucleic acid sequence.
[0085] The TC-83 replicon vector (“pVEK”) was pro­
duced by first transferring an expressible sequence encoding
kanamycin resistance (“KN(R)”) into the TC-83 full-length
clone to create pVEK/IC-92. A multiple cloning site was
inserted in place of the TC-83 structural protein genes by
digesting an existing VEE replicon (such as the pERK
plasmid, see U.S. Patent Publication No. 2002-141975,
Example 2), which has the VEE 26S promoter and 3' UTR
(untranslated region), with Apal and Notl restriction
enzymes and ligating that fragment into the same sites of
pVEK/IC-92. The resulting plasmid is replicated in bacteria
using the COLEI origin of replication (ORI) and contains
the TC-83 5' and 3‘UTR’s, TC 83 nonstructural protein (nsP)
sequences, a VEE 26S promoter, and a multiple cloning site,
all placed downstream of a T7 polymerase promoter for in
vitro RNA transcription.
[0086] Alternatively, the structural proteins of the TC-83
clone were replaced with a chimeric heterologous gene, e.g.
either the HIV gag (GAG) gene, the gene encoding the green
fluorescent protein (GFP), or an alphavirus (VEE, EEE or
WEE) glycoprotein polyprotein sequence.
[0087] A second TC-83 based replicon was produced in
which the VEE 26S promoter drives transcription of the
heterologous gene, while an internal ribosome entry site
(IRES) was inserted downstream of the promoter is used to
direct translation from the subgenomic RNA (herein referred
to as an “IRES replicon” and specifically
“VEETC83IRES”). This replicon was generated from
pERK-342EnGGAG (herein also referred to as
“ VEE3000IRES”), which is a wild-type VEE-based replicon
that contains a 342 bp sequence (SEQ ID NO:l) (an Alul
fragment from the digestion of pCDNA3.1 DNA; Invitro-
gen, Inc; Carlsbad, Calif.) inserted at the EcoRV restriction
enzyme site of pERK between the subgenomic promoter and
EMCV IRES, as an Apal-SphI fragment into pVEK-IC92.
The 342 bp sequence is inserted to insure that the IRES is the
control element for translation, and has the following
sequence:
CTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAA
using a Marligen Biosciences (Ijamsville, Md.) High Purity
Plasmid Purification System, which uses a proprietary ion
exchange resin to yield highly purified plasmid DNA. Alter­
natively, another DNA purification procedure that results in
DNA which is free of RNA, protein or endotoxin is accept­
able.
[0090] Aliquots of the purified replicon plasmid were
transcribed in vitro from Notl linearized plasmid DNA using
T7 polymerase. Typically, the T7 RiboMAX Express System
(Promega, Madison, Wis.), which contains a mixture of T7
RNA polymerase, Recombinant RNasin® RNase Inhibitor
and yeast inorganic pyrophosphatase that allows for large
scale RNA production, was used. The resulting RNA was
then purified using the RNeasy Midi kit (Qiagen, Valencia,
Calif.), which utilizes a silica-gel-based membrane to bind
RNA and purify it away from contaminating protein. Alter­
natively, another RNA purification scheme which results in
purified RNA in water that is free of RNases is acceptable.
Example 2
Production of TC-83 Helpers
[0091] A. DNA Helper
[0092] A TC-83 DNA helper was constructed from
pCDNA-VSp, which is described in U.S. Patent Publication
No. 2003-0119182, Example 5. pCDNA-VSp is a DNA
helper in which the VEE3014 VEE structural proteins are
expressed directly from a CMV promoter. The glycoprotein
gene sequence containing the TC-83 mutations was digested
from pVE/IC-92 using Spel and Seal restriction enzymes,
and ligated into pCDNA-Vsp which has been digested with
the same enzymes. The introduced mutation at El-119,
which was noted but uncorrected by Kinney et al. (1993) J.
Virol, supra as an artifact of the cDNA cloning to produce
VE/IC-92, was repaired using the quick change site-directed
mutagenesis kit (Stratagene, LaJolla, Calif.) and primers
TC83E1119F (GCCTTGCGGATCATGCTGMG-
CATATAAAGCGC) (SEQ ID NO:2) and TC83EU19R
(GCGCTTTATATGCTTCAGCATGATCCGCAAGGC)
(SEQ ID NO:3) to generate pCDNA-TC83r.
[0093] E. coli cultures transformed with the DNA helper
plasmids were sent to Puresyn, Inc. (Malvern, Pa.) where
they were grown up and the resulting DNA was purified
using their PolyFlo® technology, resulting in a DNA prepa­
ration that was at least 5 mg/ml and free of detectable RNA,
ssDNA, linear plasmid or chromosomal DNA.
AAAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATC [0094] B. RNA Helpers
r'rprrtrpr'r'n a rrr ATTir" haphapj rpr,ri a ttvr'n 7\r ^INUilO, 1> flJJOi VlilO, 111.^ Wtlt UUdltU
with 50 fi\ of 0.05 M sodium carbonate buffer, pH 9.6 (Sigma
Chemical Co., St. Louis, Mo.) containing 40-80 ng his-p55
per well. Plates were covered with adhesive plastic and
incubated overnight at 4° C. The next day, unbound antigen
was discarded, and plates were incubated for 1 hour with
200 jA blocking buffer (PBS containing 3% w/v BSA) at
room temperature. Wells were washed 6 times with PBS and
50 fA of test serum, diluted serially two-fold in buffer (PBS
with 1% w/v BSA and 0.05% v/v Tween 20), was added to
antigen-coated wells. Mouse anti-p24 monoclonal antibody
(Zeptometrix, Buffalo, N.Y.) was included in every assay as
a positive control. Negative controls in each assay included
blanks (wells with all reagents and treatments except semm)
and pre-bleed sera. Plates were incubated for one hour at
room temperature, and then rinsed 6 times with PBS. 50
/d/well of alkaline phosphatase (AP)-conjugated goat anti­
mouse poly-isotype secondary antibody (Sigma) diluted to a
predetermined concentration in diluent buffer was added to
each well and incubated for 1 hour at room temperature.
Wells were rinsed 6 times with PBS before addition of 100
/rL p-nitrophenyl phosphate (pNPP) substrate (Sigma). The
serum antibody ELISA titer was defined as the inverse of the
greatest serum dilution giving an optical density at 405 nm
greater than or equal to 0.2 above the background (blank
wells).
[0120] GAG antigen-specific Interferon-gamma (IFN-y)
secreting cells were detected using an IFN-.YELISPOT
Assay. Single-cell suspensions of splenic lymphocytes from
TC-83 VRP-GAG-immunized BALB/'c mice were prepared
by physical disruption of the splenic capsule in R-10
medium (RPMI medium 1640 supplemented with 100 U/ml
penicillin, 100 ^tg/ml streptomycin, 0.1 mM MEM non-
essential amino acids solution, 0.01 M HEPES, 2 mM
glutamine and 10% heat inactivated fetal calf serum). Lym­
phocytes were isolated by Lympholyte M density gradient
centrifugation (Accurate Scientific, Westbury, N.Y.), washed
twice and resuspended in fresh R-10 medium. Total, unsepa­
rated splenic lymphocyte populations were tested.
[0121] A mouse IFN .YELISPOT kit (Monoclonal Anti­
body Technology, Nacka, Sweden) was used to perform the
assay. Viable cells were seeded into individual ELISPOT
wells in a Multiscreen Immobilon-P ELISPOT plate
(ELISPOT certified 96-well filtration plate, Millipore, Bed­
ford, Mass.) that had been pre-coated with an anti-IFN-y
monoclonal antibody, and incubated for 16-20 hours. Cells
were removed by multiple washes with buffer and the wells
were incubated with a biotinylated anti-IFN-y monoclonal
antibody, followed by washing and incubation with Avidin-
Peroxidase-Complex (Vectastain ABC Peroxidase Kit, Vec­
tor Laboratories, Burlingame, Calif.). Following incubation,
the wells were washed and incubated for 4 minutes at room
temperature with substrate (Avidin-Peroxidase Complex
tablets, Sigma) to facilitate formation of spots, which rep­
resent the positions of the individual IFN-y-secreting cells
during culture. Plates were enumerated by automated analy­
sis with a Zeiss KS ELISPOT system.
[0122] To enumerate Gag-specific IFN-y secreting cells in
lymphocytes from mice immunized with various VRP con­
structs expressing gag, lymphocytes were stimulated with
the immunodominant CD8H-2 Kd-restricted HIV-Gag pep­
tide, or an irrelevant CD8H-2 Kd-restricted Influenza-HA
peptide for 16-20 hours (5% C02 at 37° C.). The peptides
■•AntrAl vxroc tpctprl at DO
/rg/ml. Cells minus peptide serve as a background control.
As a positive control, cells were stimulated with 4 fig/mL
concanavalin A for a similar time period. Peptides were
synthesized and purified to >90% at New England Peptide.
[0123] C. VEE Neutralization Assay
[0124] Neutralizing antibody activity against Venezuelan
equine encephalitis (VEE) virus was measured in serum
samples of immunized animals (mice or cynomolgus mon­
keys) using VEE replicon particles (VRP). This test is
designed to assess the prevention of productive VRP infec­
tion of VRP-susceptible cells by neutralizing antibodies that
are present in the serum. In this assay, a defined quantity of
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
19
Dec. 1, 2005
propagation-defective VRP expressing green fluorescent
protein (GFP) is mixed with serial dilutions of the animal’s
serum, incubated, and inoculated onto cell monolayers.
Following another period of incubation, the cell monolayers
are examined for GFP-positive cells under UV light. The
infectivity of GFP-expressing VRP (“GFP-VRP”) is pre­
vented, or “neutralized”, by VEE virus specific neutralizing
antibodies in the serum.
[0125] The assay is performed as follows: Day 1: Serum
from immunized animals (mice or cynomolgus monkeys) is
heat inactivated at 56° C. for 30 minutes, and then serially
diluted in media (MEM with Earle’s Salts and L-glutamine,
Invitrogen 11095072, supplemented with 0.1 mM Non-
Essential Amino Acids, 100 U/ml penicillin and 100 /rg/ml
streptomycin). These dilutions are mixed with a defined
quantity (between 5xl03 and 1.5xl04) of GFP-VRP and
incubated overnight at 4° C. Day 2: 50 fA of the serum:GFP-
VRP mixture is added to a 96-well plate of confluent Vero
cells and incubated at 37° C. for one hour. The serum:GFP-
VRP mixture is removed and replaced with 100 /A of fresh
media and incubated overnight at 37° C. Day 3: the number
of GFP-positive cells are quantified under UV light. The
80% neutralization level is determined for each sample and
is defined as the greatest serum dilution giving a mean
GFP-positive cells (GPC) per grid that is less than or equal
to 20% of the number of GPCs per grid in control wells
infected with GFP-VRP alone or with GFP-VRP pre-incu­
bated with negative control sera (i.e. pre-immunization
sera).
TABLE 15
Anti-VEE responses in Mice immunized with GAG-VRP
Anti-Vector Response
GAG _____________(GMT)
VRP VEE strain Dose after 1st boost after 2nd boost
l'C-83 1 e4 1* 1
TC-83 1 e5 1 1
TC-83 1 e6 1 1
VEE3014 1 e4 1 1
VEE3014 1 eb 1 32
VEE3000 1 e3 2 2
VEE3000 1 e4 15 70
VEE3000 1 e6 8914 40960
TC-83IRES 1 e6 1 1
TC-83(E181I)IRES 1 c6 1 1
VEE 3014IRES 1 e6 2 36
*To calculate GMT anti-vector titers of <1:10 were arbitrarily assigned a
value of 1.
[0126]
TABLE 16
Anti-VEE responses in Cynomolgus monkeys immunized with GAG-VRP
VEE
replicon #d Rte2
2 W3
PP4
4 W
PP
2 W
PB5
4 W
PB
6 W
PB
8 W
PB
12 W
PB
14 W
PB
16 W
PB
20 W
PB
TC-83 1 s.c. ^10 ^10 80 40 40 20 10 10 10 10
TC-83 2 s.c. ^10 ^10 ^10 ^10 ^10 ^10 20 40 20 40
TC-83 3 s.c. 10 <10 160 320 320 320 160 160 160 80
TC-83 1 i.m. ^10 ^10 ^10 ^10 ^10 20 ^10 ^10 ^10 ^10
TC-83 2 i.m. ^10 ^10 ^10 10 10 40 ^10 10 ^10 ^10
TC-83 3 i.m. ^10 ^10 ^10 10 ^10 40 ^10 20 ^10 ^10
3014 1 s.c. 640 640 20480 10240 10240 5120 1280 1280 1280 1280
3014 2 s.c. 10 10 640 640 1280 640 160 80 80 160
3014 3 s.c. 1280 640 10240 5120 5120 2560 1280 1280 2560 2560
3014 1 i.m. 160 80 40960 40960 10240 5120 5120 2560 2560 2560
3014 2 i.m. 640 40 5120 10240 2560 1280 640 640 640 320
3014 3 i.m. 20 10 2560 5120 1280 640 640 320 320 320
■‘•animal identification number
2route of administration: s.c. = subcutaneous; i.m. = intramuscular
3W = week
4PP = post-priming inoculation
5PB = post-first boosting inoculation
[0127]
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 5
<210> SEQ ID NO 1
<211> LENGTH: 342
<212> TYPE: DNA
<213> ORGANISM: Artificial
<220> FEATURE:
<223> OTHER INFORMATION: cloned DNA fragment to insure proper
translational control.
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
20
Dec. 1, 2005
-continued
<400> SEQUENCE: 1
ctattccaga agtagtgagg aggctttttt ggaggcctag gcttttgcaa aaagcttgta 60
tatccatttt cggatctgat caagagacag gatgaggatc gtttcgcatg attgaacaag 120
atggattgca cgcaggttct ccggccgctt gggtggagag gctattcggc tatgactggg 180
cacaacagac aatcggctgc tctgatgccg ccgtgttccg gctgtcagcg caggggcgcc 240
cggttctttt tgtcaagacc gacctgtccg gtgccctgaa tgaactgcag gacgaggcag 300
cgcggctatc gtggctggcc acgacgggcg ttccttgcgc ag 342
<210> SEQ ID NO 2
<2ii> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial
<220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide useful as a primer.
<400> SEQUENCE: 2
gccttgcgga tcatgctgaa gcatataaag cgc 33
<210> SEQ ID NO 3
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial
<220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide useful a as a primer.
<400> SEQUENCE: 3
gcgctttata tgcttcagca tgatccgcaa ggc 33
<210> SEQ ID NO 4
<211> LENGTH: 2931
<212> TYPE: DNA
<213> ORGANISM: Artificial
<220> FEATURE:
<223> OTHER INFORMATION: Western equine encephalitis virus cassette.
<400> SEQUENCE: 4
tcactagtta cagcgctgtg cgtgctttcg aatgtcacat tcccttgcga caaaccaccc 60
gtgtgctatt cactggcgcc agaacgaaca ctcgacgtgc tcgaggagaa cgtcgacaat 120
ccaaattacg acacgctgct ggagaacgtc ttgaaatgtc catcacgccg gcccaaacga 180
agcattaccg atgacttcac gctgaccagt ccctacctgg ggttctgccc gtattgcaga 240
cactcagcgc catgttttag cccaataaaa attgagaacg tgtgggacga atctgatgat 300
gggtcgatta gaatccaggt ctcggcacaa ttcggctaca atcaggcagg cactgcagac 360
gtcaccaagt tccggtacat gtcttacgac cacgaccatg acatcaagga a ga c a gt at g 42 0
gagaaattag ctattagtac atccggacca tgccgtcgtc ttggccacaa agggtacttc 480
ctgttagctc aatgtcctcc aggtgacagt gtaaccgtca gtatcacgag cggagcatct 540
gagaattcat gcaccgtgga gaaaaagatc aggaggaagt ttgtcggtag agaggagtac 600
ttgttcccac ctgtccatgg aaagctggta aagtgccacg tttacgatca cttgaaggag 660
acgtctgccg gatatataac tatgcacagg ccaggcccac acgcgtataa gtcctacctg 720
gaggaagcgt caggcgaagt gtacattaaa ccaccttctg gcaagaacgt cacctacgaa 780
tgtaagtgtg gtgactacag cacaggtatt gtgagcacgc gaacgaagat gaacggctgc 840
, EAST Version: 3.3.1.211/13/2017
US 2005/0266550 A1
21
Dec. 1, 2005
-continued
actaaagcaa aacaatgcat tgcctacaag cgcgaccaaa cgaaatgggt cttcaactcg 900
ccggatctta ttaggcacac agaccactca gtgcaaggta aactgcacat tccattccgc 960
ttgacaccga cagtctgccc ggttccgtta gctcacacgc ctacagtcac gaagtggttc 1020
aaaggcatca ccctccacct gactgcaacg cgaccaacat tgctgacaac gagaaaattg 1080
gggctgcgag cagacgcaac agcagaatgg attacgggga ctacatccag gaatttttct 1140
gtggggcgag aagggctgga gtacgtatgg ggcaaccatg aaccagtcag agtctgggcc 1200
caggagtcgg caccaggcga cccgcatgga tggccgcatg agatcatcat ccattattat 1260
catcggcatc cagtctacac tgtcattgtg ctgtgcggtg tcgctctggc tatcctggta 1320
ggcactgcat cgtcagcagc ttgtatcgcc aaagcaagaa gagactgcct gacgccatac 1380
gcgcttgcac cgaacgcaac ggtacccaca gcattagcag ttttgtgctg tattcggcca 1440
accaacgctg aaacatttgg agaaactttg aaccatctgt ggtttaacaa ccaaccgttt 1500
ctctgggcac agttgtgcat ccctctggca gcgcttatta ttctgttccg ctgcttttca 1560
tgctgcatgc cttttttatt ggttgcaggc gtctgcctgg ggaaggtaga cgccttcgaa 1620
catgcgacca ctgtgccaaa tgttccgggg atcccgtata aggcgttggt cgaacgtgca 1680
ggttacgcgc cacttaatct ggagattacg gtcgtctcat cggaattaac accctcaact 1740
aacaaggagt acgtgacctg caaatttcac acagtcgttc cttcaccaca agttaaatgc 1800
tgcgggtccc tcgagtgtaa ggcatcctca aaagcggatt acacatgccg cgtttttggc 1860
ggtgtgtacc ctttcatgtg gggaggcgca cagtgcttct gtgacagtga gaacacacaa 1920
ctgagtgagg catacgtcga gttcgctcca gactgcacta tagatcatgc agtcgcacta 1980
aaagttcaca cagctgctct gaaagtcggc ctgcgtatag tatacggcaa taccacagcg 2040
cgcctggata cattcgtcaa cggcgtcaca ccaggttcct cacgggacct gaaggtcata 2100
gcagggccga tatcagcagc tttttcaccc tttgaccata aggtcgtcat tagaaagggg 2160
cttgtttaca actacgactt ccctgagtat ggagctatga acccaggagc gttcggcgat 2220
attcaagcat cctctcttga tgccacagac atagtagccc gcaccgacat acggctgctg 2280
aagccttctg tcaagaacat ccacgtcccc tacacccaag cagtatcagg gtatgaaatg 2340
tggaagaaca actcaggacg acccctgcaa gaaacagcac cattcggatg taaaattgaa 2400
gtggagcctc tgcgagcgac taactgtgct tatgggcaca tccctatctc gattgacatc 2460
cctgatgcag cttttgtgag atcatctgaa tcaccaacaa ttttagaagt cagctgcaca 2520
gtagcagact gcatttattc tgcagacttt ggtggttcgc taacactaca gtacaaagct 2580
aacagagagg gacattgtcc agttcactcc cactccacta cagctgtttt gaaggaagcg 2640
accacacatg tgactgccac a g g c a g c a t a acactacatt ttagcacatc gagcccacaa 2 70 0
gcaaatttca tagtttcgct atgcggcaag aagaccacct gcaatgctga atgtaaacca 2760
ccggccgacc acataattgg agaaccacat aaggtcgacc aagaattcca ggcggcagtt 2820
tccaaaacat cttggaactg gctgcttgca ctgtttgggg gagcatcatc cctcattgtt 2880
gtaggactta tagtgttggt ctgcagctct
<210> SEQ ID NO 5
<211> LENGTH: 2943
<212> TYPE: DNA
<213> ORGANISM: Artificial
<220> FEATURE:
atgcttataa acacacgtag a 2931
, EAST Version: 3.3.1.211/13/2017
US 2005/0266550 A1
22
Dec. 1, 2005
-continued
<223> OTHER INFORMATION: Eastern equine encephalitis virus cassette.
<400> SEQUENCE: 5
tcgctcgcca ctgttatgtg cgtcctggcc aatatcacgt ttccatgtga tcaaccaccc 60
tgcatgccat gctgttatga aaagaatcca cacgaaacac tcaccatgct ggaacagaat 120
tacgacagcc gagcctatga tcagctgctc gatgccgctg tgaaatgtaa tgctaggaga 180
accaggagag atttggacac tcatttcacc cagtataagt tggcacgccc gtatattgct 240
gattgcccta actgtgggca tagtcggtgc gacagcccta tagctataga agaagtcaga 300
ggggatgcgc atgcaggagt catccgcatc cagacatcag ctatgttcgg tctgaagacg 360
gatggagtcg atttggccta catgagtttc atgaacggca aaacgcagaa atcaataaag 420
atcgacaacc tgcatgtgcg cacctcagcc ccttgttccc tcgtgtcgca ccacggctat 480
tacatcttgg ctcaatgccc accaggggac acggttacag ttgggtttca cgacgggcct 540
aaccgccata cgtgcacagt tgcccataag gtagaattca ggccagtggg tagagagaaa 600
taccgtcacc cacctgaaca tggagttgaa ctaccgtgta accgttacac tcacaagcgt 660
gcagaccaag gacactatgt tgagatgcat caaccagggc tagttgccga ccactctctc 720
cttagcatcc acagtgccaa ggtgaaaatt acggtaccga gcggcgccca agtgaaatac 780
tactgcaagt gtccagatgt acgagaggga attaccagca gcgaccatac aaccacctgc 840
acggatgtca aacaatgcag ggcttacctg attgacaaca agaaatgggt gtacaactct 900
ggaagactgc ctcgaggaga gggcgacact tttaaaggaa aacttcatgt gccctttgtg 960
cctgttaagg ccaagtgcat cgccacgctg gcaccggagc ctctagttga gcacaaacac 1020
cgcaccctga ttttacacct gcacccggac catccgacct tgctgacgac caggtcactt 1080
ggaagtgatg caaatccaac tcgacaatgg attgagcgac caacaactgt caatttcaca 1140
gtcaccggag aagggttgga gtatacctgg ggaaaccatc caccaaaaag agtatgggct 1200
caagagtcag gagaagggaa cccacatgga tggccgcacg aagtggtagt ctattactac 1260
aacagatacc cgttaaccac aattatcggg ttatgcacct gtgtggctat catcatggtc 1320
tcttgtgtca catccgtgtg gctcctttgc aggactcgca atctttgcat aaccccgtat 1380
aaactagccc cgaacgctca agtcccaata ctcctggcgt tactttgctg cattaagccg 1440
acgagggcag acgacacctt gcaagtgctg aattatctgt ggaacaacaa tcaaaacttt 1500
ttctggatgc agacgcttat cccacttgca gcgcttatcg tatgcatgcg catgctgcgc 1560
tgcttatttt gctgtgggcc ggctttttta cttgtctgcg gcgccttggg cgccgcagcg 1620
tacgaacaca cagcagtgat gccgaacaag gtggggatcc cgtataaagc tttagtcgaa 1680
cgcccagy-c-c atgcauccgt tcatctacag atacagctgg ttaataccag gataattcca 174 0
tcaactaacc tggagtacat cacctgcaag tacaagacaa aagtgccgtc tccagtagtg 1800
aaatgctgcg gtgccactca atgtacctcc aaaccccatc ctgactatca gtgtcaggtg 1860
tttacaggtg tttacccatt catgtgggga ggagcctact gcttctgcga caccgaaaac 1920
acccagatga gcgaggcgta tgtagagcgc tcggaagagt gctctatcga ccacgcaaaa 1980
gcttataaag tacacacagg cactgttcag gcaatggtga acataactta tgggagcgtc 2040
agctggagat ctgcagatgt ctacgtcaat ggtgaaactc ccgcgaaaat aggagatgcc 2100
aaactcatca taggtccact gtcatctgcg tggtccccat tcgataacaa ggtggtggtt 2160
, EAST Version: 3.3.1.211/13/2017
US 2005/0266550 A1
23
Dec. 1, 2005
-continued
tatgggcatg aagtgtataa ttacgacttt cctgagtacg gcaccggcaa ageaggetet 2220
tttggagacc tgcaatcacg cacatcaacc agcaacgatc tgtacgcaaa caccaacttg 2280
aagctacaac gaccccaggc tggtatcgtg cacacacctt tcacccaggc gccctctggc 2340
ttegaaegat ggaaaaggga caaaggggca ccgttgaacg acgtagcccc gtttggctgt 2400
tcgattgccc tggagccgct ccgtgcagaa aattgtgcag tgggaagciat ccctatatct 2460
atagatatac ccgatgcggc tttcactaga atatctgaaa caccgacagt ctcagacctg 2520
gaatgcaaaa ttacggagtg taettatgee teegattteg gtggtatagc caccgttgcc 2580
tacaaatcca gtaaagcagg aaactgtcca attcattctc catcaggtgt tgcagttatt 2640
aaagagaatg acgtcaccct tgctgagagc ggatcattta cattccactt ctccactgca 2700
aacatccatc ctgcttttaa gctgcaggtc tgcaccagtg cagttacctg caaaggagat 2760
tgcaagccac egaaagatea tategtegat tatccagcac aacataccga atcctttacg 2820
teggegatat ccgccaccgc gtggtcgtgg ctaaaagtgc tggtaggagg aacatcagca 2880
tttattgttc tggggcttat tgctacagca gtggttgccc tagttctgtt cttccataga 2940
cat 2943
What is claimed is:
1. A method for preparing TC-83 derived alphaviral
replicon particles (ARPs), said method comprising the steps
of:
(a) introducing a TC-83-derived alphaviral replicon
nucleic acid into a host cell, said replicon nucleic acid
comprising at least a vims packaging signal and at least
one heterologous coding or functional sequence
expressible in said alphaviral replicon nucleic acid,
wherein said host cell comprises at least one helper
function, to produce a modified host cell;
(b) culturing said modified host cell under conditions
allowing expression of the at least one helper function,
allowing replication of said TC-83-derived alphaviral
replicon nucleic acid and packaging of said alphaviral
replicon nucleic acid to form ARPs;
2. The method of claim 1, further comprising the steps of:
(c) contacting the modified host cells after step (b) with an
aqueous solution having an ionic strength of at least 0.2
M to release the ARPs into the aqueous solution to
produce a ARP-containing solution;
(d) collecting ARPs from the ARP-containing solution of
3. The method of claim 1 or 2, wherein the at least one
helper function in the host cell of step (a) is encoded by a
nucleic acid sequence stably integrated within the genome of
said host cell.
4. The method of claim 1, wherein the at least one helper
function in the host cell is introduced on at least one helper
nucleic acid which encodes a capsid protein capable of
binding said alphaviral replicon nucleic acid, and at least one
alphaviral glycoprotein, wherein said alphaviral glycopro­
tein associates with said alphaviral replicon nucleic acid and
said capsid protein, wherein the at least one helper nucleic
acid molecule is introduced into the host cell together with
said alphaviral replicon nucleic acid.
5. The method of claim 1, wherein the at least one helper
function is encoded by at least two helper nucleic acid
molecules wherein each of said two helper nucleic acid
molecules encodes at least one viral helper function.
6. The method of claim 2, wherein the ionic strength is
between 0.5 M and 5 M.
7. The method of claim 1, wherein the at least one helper
nucleic acid molecule is a DNA molecule.
8. The method of claim 1, wherein the replicon nucleic
acid is introduced into said host cell by electroporation.
9. The method of claim 1 or 2, further comprising a cell
washing step, prior to step (c) of claim 2.
10. The method of claim 9, wherein the cell washing
solution contains no salt and further comprises DNAse.
11. A method of preparing TC-83 derived alphavirus
replicon particles comprising introducing an alphavirus rep­
licon vector and one or more helper nucleic acid molecules
into an alphavirus-permissible cells via electroporation,
wherein the alphavirus-permissive cells in a culture medium
during electroporation are at a concentration of least 10s
cells/ml medium and wherein the alphavirus RNA replicon
vector added to the cells prior to electroporation at a
concentration of approximately 35 per ml.
12. The method of claims of claim 1 or 11, wherein the
electroporation is carried out in an electroporation cuvette
wherein a gap between electrodes is between 0.4 and 1.0 cm.
13. The method of claim 10, wherein the helper nucleic
acid is a single DNA molecule encoding all alphavirus
structural proteins.
14. The method of claim 13, wherein the DNA helper is
at a concentration of least 100 /rg/ml.
15. The method of claim 1 or 11, wherein the alphavirus-
permissible cell culture is a Vero cell culture.
16. The method of claim 1 or 11, wherein step (d) is
followed by an ion exchange chromatography step.
17. The method of claim 1 or 11, wherein the salt wash
step used in the method is selected from the group consisting
11/13/2017, EAST Version: 3.3.1.2
US 2005/0266550 A1
24
Dec. 1, 2005
of NaCl, KC1, MgCl2, CaCl2, NH4C1, (NH4)2S04,
NH4HCO3.. and NH4 Acetate
18. An alphavirus replicon particle preparation prepared
by the method of claim 1 or 17.
19. An TC-83-derived alphavirus replicon nucleic acid.
20. A method of producing an immune response in a
subject, comprising administering to the subject an effective
amount of a composition comprising infectious, propaga­
tion-defective alphavirus particles and a pharmaceutically-
acceptable carrier, wherein each particle comprises an
alphavirus replicon RNA comprising an alphavirus packag­
ing signal and one or more heterologous RNA sequence(s)
encoding an immunogen, and wherein said alphavirus rep­
licon RNA lacks sequences encoding alphavirus structural
proteins, and wherein each particle comprises structural
proteins from VEETG83.
21. The method of claim 20, wherein the composition is
administered via intramuscular, subcutaneous or intraperi-
toneal injection.
22. The method of claim 20, wherein the alphavirus
replicon RNA is from Venezuelan equine encephalitis virus,
there are two heterologous RNA sequences.
24. A composition comprising infectious, propagation-
defective alphavirus particles, wherein the particles com­
prise Venezuelan equine encephalitis virus TC83 structural
proteins and an alphavirus replicon RNA, said alphavirus
replicon RNA comprising an alphavirus packaging signal
and one or more heterologous RNA sequence(s) encoding at
least one immunogen, and said alphavirus replicon RNA
lacking sequences encoding structural proteins.
25. The composition of claim 24, wherein the alphavirus
replicon RNA is from Venezuelan equine encephalitis virus.
26. The composition of claim 24, wherein said composi­
tion is a pharmaceutical formulation.
27. A helper cell for producing infectious, propagation-
defective alphavirus particles comprising:
(a) an alphavims replicon RNA encoding a heterologous
RNA sequence and lacking sequences encoding
alphavirus structural proteins;
(b) a first helper RNA encoding at least one but not all
Venezuelan equine encephalitis virus TC83 structural
proteins; and
(c) a second helper RNA not encoding at least one
Venezuelan equine encephalitis virus TC83 structural
protein encoded by the first helper RNA and encoding
at least one Venezuelan equine encephalitis virus TC83
structural protein not encoded by the first helper RNA.
28. A helper cell for producing infectious, propagation-
defective alphavirus particles comprising:
(a) an alphavims replicon RNA encoding a heterologous
RNA sequence and lacking sequences encoding
alphavims structural proteins; and
(b) one or more helper DNA plasmids encoding all of the
Venezuelan equine encephalitis vims TC83 stmctural
proteins.
11/13/2017, EAST Version: 3.3.1.2