Ex parte FRANKEDownload PDFBoard of Patent Appeals and InterferencesDec 23, 199707892598 (B.P.A.I. Dec. 23, 1997) Copy Citation Application for patent filed May 29, 1992. According to appellant, the application1 is a continuation of Application 07/393,618, filed August 14, 1989, now abandoned; which is a continuation of Application 06/657,091, filed October 2, 1984, now Patent No. 4,935,370; which is a continuation-in-part of Application 06/564,962, filed December 23, 1983, now abandoned. 1 THIS OPINION WAS NOT WRITTEN FOR PUBLICATION The opinion in support of the decision being entered today (1) was not written for publication in a law journal and (2) is not binding precedent of the Board. Paper No. 27 UNITED STATES PATENT AND TRADEMARK OFFICE __________ BEFORE THE BOARD OF PATENT APPEALS AND INTERFERENCES __________ Ex parte ARTHUR E. FRANKE __________ Appeal No. 94-3279 Application 07/892,5981 __________ ON BRIEF __________ Before WINTERS, WILLIAM F. SMITH, and GRON, Administrative Patent Judges. WILLIAM F. SMITH, Administrative Patent Judge. Appeal No. 94-3279 Application 07/892,598 2 DECISION ON APPEAL This is an appeal under 35 U.S.C. § 134 from the final rejection of claims 67 through 70 and 72 through 79, all the claims in the application. Claims 80, 81, and 82 are illustrative of the subject matter on appeal and read as follows: 80. A process for using an E. coli comprising an expression plasmid comprising: (i) an E. coli trp promoter; (ii) the nucleotide sequence TAAAAAGGAGAATTC encoding a ribosome binding site for translation of element (iii); and (iii) a structural gene coding the amino acid sequence of a heterologous protein, to produce said heterologous protein, which process comprises cultivating said E. coli comprising said expression plasmid in an aqueous medium comprising an assimilable source of carbon, nitrogen and inorganic salts. 81. A process for using an E. coli comprising an expression plasmid comprising: (i) an E. coli trp promoter; (ii) the nucleotide sequence TAAAAAGGGTATCGAGAATTC encoding a ribosome binding site for translation of element (iii); and (iii) a structural gene coding the amino acid sequence of a heterologous protein, to produce said heterologous protein, which process comprises cultivating said E. coli comprising said expression plasmid in an aqueous medium comprising an assimilable source of carbon, nitrogen and inorganic salts. 82. A process for using a microorganism selected from the group consisting of E. coli K-12 strains comprising plasmid pPFZ-R2 and E. coli strains comprising plasmid pPFZ-R4 to produce prorennin, which process comprises cultivating said microorganism in an aqueous nutrient medium comprising an assimilable source of carbon, nitrogen and Appeal No. 94-3279 Application 07/892,598 3 inorganic salts until a substantial amount of prorennin is expressed; and isolating said prorennin. The reference relied upon by the examiner are: Alford et al. (Alford) 4,666,847 May 19, 1987 Goeddel et al. (Goeddel), “Direct expression in Escherichia coli of a DNA sequence coding for human growth hormone,” Nature, vol. 281, p. 544-48 (1979) Claims 67, 68, 72, and 80 through 86 stand rejected under 35 U.S.C. § 103 as unpatentable over Alford. Claims 69 and 70 stand rejected under 35 U.S.C. § 103 as unpatentable over Goeddel. After considering the record in this appeal, we hold that the examiner has not established a prima facie case of obviousness. See In re Brouwer, 77 F.3d 422, 37 USPQ2d 1663 (Fed. Cir. 1996); In re Ochiai, 71 F.3d 1565, 37 USPQ2d 1127 (Fed. Cir. 1995). Accordingly, we reverse the two rejections under 35 U.S.C. § 103 which are pending in this appeal. No time period for taking any subsequent action in connection with this appeal may be extended under 37 CFR § 1.136(a). REVERSED Appeal No. 94-3279 Application 07/892,598 4 Sherman D. Winters ) Administrative Patent Judge ) ) ) ) BOARD OF PATENT William F. Smith ) APPEALS AND Administrative Patent Judge ) INTERFERENCES ) ) ) Teddy S. Gron ) Administrative Patent Judge ) J. Trevor Lumb Pfizer Inc. Eastern Pint Road Groton, CT 06340 Copy with citationCopy as parenthetical citation